ID: 1104405720

View in Genome Browser
Species Human (GRCh38)
Location 12:128515064-128515086
Sequence GGAACTTGTCCAATATGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104405720_1104405725 17 Left 1104405720 12:128515064-128515086 CCCTAGCATATTGGACAAGTTCC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1104405725 12:128515104-128515126 TCTTTCATAGTGGACTTCATCGG 0: 1
1: 0
2: 0
3: 7
4: 122
1104405720_1104405724 7 Left 1104405720 12:128515064-128515086 CCCTAGCATATTGGACAAGTTCC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1104405724 12:128515094-128515116 AATCGAATAATCTTTCATAGTGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104405720 Original CRISPR GGAACTTGTCCAATATGCTA GGG (reversed) Intronic
905278919 1:36836588-36836610 GGAAAGTATACAATATGCTAAGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906667363 1:47631434-47631456 GGCAGTTTTCCAATATGCTGGGG + Intergenic
906876055 1:49540855-49540877 ATAACTTGTTCATTATGCTAAGG - Intronic
907333620 1:53686863-53686885 GGGCCTTGTCCACCATGCTAGGG + Intronic
907585860 1:55617289-55617311 GGGACTTGGCCAATATGTAAAGG - Intergenic
909295362 1:73940770-73940792 GTATCTTGTCCATCATGCTAAGG + Intergenic
909325431 1:74346166-74346188 AGAACTTGTCCAAGATCCTCTGG + Intronic
910141285 1:84029966-84029988 GGAATTTTTCCAAAATCCTAAGG - Intergenic
913231859 1:116746607-116746629 GTAGCTTGTCCAAAATTCTATGG + Intergenic
913395904 1:118372023-118372045 GGAACTTCTTCAATATGATGAGG - Intergenic
915606932 1:156958282-156958304 TGAACTAGTGCAATATACTAAGG - Intronic
915867816 1:159523931-159523953 GGAAAATGTCCTATGTGCTATGG + Intergenic
917361447 1:174181020-174181042 GTAACTTGTCCTATATGATATGG + Intronic
922879899 1:228972821-228972843 GGACCTTCTCCAAGAAGCTAAGG - Intergenic
1066252829 10:33651039-33651061 GGAATTTCTCCAATATACTCAGG + Intergenic
1067778968 10:49184964-49184986 GCAACGTGTTCAGTATGCTATGG + Intronic
1068383448 10:56291230-56291252 GGAAAATGTCCCATGTGCTAAGG + Intergenic
1069181119 10:65359893-65359915 GCAACTTTTCCAATATACTTAGG - Intergenic
1071252692 10:83837140-83837162 GGAAATTGTTGAATATGTTATGG + Intergenic
1071887347 10:89965577-89965599 GGACATTGGCCAATATGATATGG + Intergenic
1074409898 10:113219165-113219187 GGAACTTGTACAATTTTCTCAGG + Intergenic
1077650151 11:3964110-3964132 TTAACTTGTCCAATATCTTATGG + Intronic
1087890531 11:103532841-103532863 GGAAGTTTTCCTACATGCTAGGG - Intergenic
1089155761 11:116401145-116401167 GTAACTTGTCCAACATCCCATGG - Intergenic
1091005185 11:131946813-131946835 GGAACTAGTGAAATATGTTATGG - Intronic
1096851022 12:54437518-54437540 GGAATGTTTCCAATATCCTATGG + Intergenic
1099758495 12:86887608-86887630 GGAACTTGTTCTATGTCCTAGGG - Intergenic
1101147890 12:101858521-101858543 GGACCTTGTGTAACATGCTAAGG - Intergenic
1103310031 12:119998385-119998407 GCAACTTGTCCTATGTGGTAGGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104405720 12:128515064-128515086 GGAACTTGTCCAATATGCTAGGG - Intronic
1109109724 13:58301280-58301302 GTAACTTTACCAATATTCTATGG + Intergenic
1109769683 13:66954591-66954613 AGATTTTGTCCAAGATGCTATGG - Intronic
1111588745 13:90315641-90315663 GGAACTTCTCAAACTTGCTAGGG + Intergenic
1111836603 13:93395987-93396009 GGAACTTGTCCTATATAGTTTGG + Intronic
1112901234 13:104359947-104359969 GGAAATTAAACAATATGCTATGG - Intergenic
1114809671 14:25883014-25883036 GGAACTTATCCAATTTACTTTGG - Intergenic
1116701453 14:48248471-48248493 TGAACTTGTTCAATATGGAATGG + Intergenic
1117196648 14:53346367-53346389 GAAACATGTCCAATATCCAAAGG + Intergenic
1127636223 15:60872768-60872790 GGAGCTTGTGCACCATGCTAAGG - Intronic
1127777305 15:62275196-62275218 GGAACTGGTTCAATAAACTATGG - Intergenic
1127831475 15:62754980-62755002 GGAACTAGTCCAAACTGCGATGG + Intronic
1134926607 16:18168662-18168684 GGAACATCTCCAATATGATAAGG + Intergenic
1135877005 16:26211744-26211766 TGAACTTATGCAATATGCCAGGG - Intergenic
1136133274 16:28238315-28238337 GCAAGTGGTCCAAGATGCTATGG - Intergenic
1139025052 16:62805855-62805877 GAAACTTCTCCAATATTCTGGGG - Intergenic
1144138313 17:12320638-12320660 GGAATTTGCCAAATATGCTCAGG - Intergenic
1147434700 17:40402713-40402735 GCAACATGTCAATTATGCTAAGG - Intronic
1149310037 17:55384685-55384707 GACACTTGTTCAAGATGCTAAGG + Intergenic
1150184397 17:63164820-63164842 GGACATTGTCCAATCTGCTGAGG - Intronic
1153084818 18:1272142-1272164 GGAAACTGTCCAATGTGATATGG + Intergenic
1156486285 18:37467731-37467753 GGACCTTGTCCAAACTGCTCTGG + Intronic
1166751454 19:45165674-45165696 GGATCTTGGCCAATATTATAAGG - Intronic
1166951462 19:46431131-46431153 GAAACTTGTAGAATCTGCTAAGG - Intergenic
926587487 2:14703977-14703999 GAAACTTGTCCAAGATCCCATGG - Intergenic
928462192 2:31485341-31485363 AGAACTTCTGCAATATGCTGGGG + Intergenic
930126915 2:47806524-47806546 GGAGCTTGTCCTAAAAGCTATGG + Exonic
930369404 2:50484472-50484494 GGAACTTTTCCTAAAGGCTAAGG + Intronic
931614953 2:64146014-64146036 GAATCTTGCACAATATGCTAAGG + Intergenic
937991887 2:127667683-127667705 GGAACTTCTTCAATTTGATAAGG + Intronic
941657608 2:168160821-168160843 GGACCTTATCCCATAGGCTAAGG - Intronic
944867581 2:203877796-203877818 GGACCTTGTCCAAGGTCCTATGG + Intergenic
946587727 2:221209065-221209087 AGAGTTTGTCCCATATGCTATGG - Intergenic
946890149 2:224267107-224267129 GGAAGTTGTCCAGTATAATATGG - Intergenic
1183892657 22:40942850-40942872 GGAACTTCTTCAATGTGATAAGG - Intergenic
951000482 3:17553908-17553930 GGAACTTGTTGAATTTTCTATGG + Intronic
954281539 3:49582796-49582818 GGAACTTTCTCAATATGATAAGG - Intronic
956383357 3:68689413-68689435 GGAACTTCCTCAATATGATAAGG - Intergenic
961414994 3:126750648-126750670 GGAACTTGCCTCACATGCTAGGG - Intronic
966563060 3:181345066-181345088 GGGCATTGTCCTATATGCTAGGG + Intergenic
967265110 3:187683796-187683818 GGAACTTATACAATTTGGTATGG + Intergenic
968835164 4:2958453-2958475 GGAACTTCTTCTATTTGCTAAGG + Intronic
973866748 4:55122286-55122308 AAAAATTGTCCACTATGCTAGGG + Intronic
974075841 4:57167722-57167744 GTAACTTGTCCAATGACCTACGG - Intergenic
979296560 4:119039240-119039262 GGAACTTGTGTAACATGGTAGGG + Intronic
981469017 4:145108369-145108391 GGGACTTTTTCAATATACTAAGG - Intronic
981486067 4:145287549-145287571 GGGAGTTGTGCAATATCCTAGGG + Intergenic
985550360 5:530089-530111 GGAACTTTTTCAATAAGCTGTGG + Intergenic
988372496 5:30389283-30389305 GGTACTTGTCAAATATGATTTGG - Intergenic
988441656 5:31240888-31240910 GGAATTTGTCCAAGTTGTTATGG - Intronic
989494624 5:42098191-42098213 GGAAATTGAACAATATGCTTCGG - Intergenic
992524566 5:77596023-77596045 GGAATTTGACCAATAGGTTATGG - Intronic
1001659681 5:173381832-173381854 GGAACATTTCCAAGATGCTCAGG + Intergenic
1003032203 6:2611615-2611637 GGAACTTGTCCGCTATGATCAGG - Intergenic
1003700930 6:8464350-8464372 AGAACTTTTAAAATATGCTATGG + Intergenic
1004898392 6:20170948-20170970 GGAAATTGGCCAGCATGCTAGGG + Intronic
1005245346 6:23877863-23877885 ACAACTTGTCCAATATCATATGG - Intergenic
1016475012 6:144418113-144418135 GTAACTTGCCCAAAATTCTATGG + Intronic
1018643761 6:165929408-165929430 GGAACGTGTCCAGAATGCTGGGG - Intronic
1023665152 7:42515146-42515168 GTAACTTGTCCAAGCTGATAGGG - Intergenic
1032903111 7:136333584-136333606 GGAACTTTTAAAATATCCTATGG - Intergenic
1039012456 8:33109558-33109580 GGCACTTGTCCATTTTTCTAAGG - Intergenic
1044927974 8:97225010-97225032 GGAACTTTTCCAGTAAGCTCGGG - Intergenic
1046528248 8:115409527-115409549 AGAACTTCTGGAATATGCTAGGG - Exonic
1047344175 8:124011063-124011085 GGCAGTTGTCCACTATGCCAGGG - Intronic
1049092727 8:140528902-140528924 AGAACTTGTCAAATGTGATAGGG + Intergenic
1056305171 9:85283289-85283311 GGTACTCCTCCAATATGCCAGGG - Intergenic
1056642344 9:88382326-88382348 GGAACTTGCCCAAGCTGGTATGG + Intergenic
1058244949 9:102611406-102611428 TGAACTTGGCCAATTTGGTATGG + Intergenic
1058537542 9:105977762-105977784 GGCACTTGTTCAAGATGGTAAGG + Intergenic
1059048603 9:110897505-110897527 AGAACTTTTCCAGCATGCTAAGG - Intronic
1186034532 X:5407084-5407106 GGAAATTATTCAAAATGCTAAGG + Intergenic
1186471862 X:9827940-9827962 GGAGCTTGTCCAAAATGCAGAGG + Intronic
1187670794 X:21664431-21664453 GGAACTTGTCCAAGGTGCCATGG + Intergenic
1188173661 X:26960947-26960969 ATAACTTGTCAAATATCCTAAGG + Intergenic
1192307619 X:69979185-69979207 GGACCTTGACTTATATGCTAAGG - Intronic
1193226899 X:78994260-78994282 GGAGCTTGTCAAAGATGCTAAGG + Intergenic
1193255268 X:79341594-79341616 GGAATTTGTCCTATATTCTAAGG + Intergenic
1195571141 X:106399796-106399818 TGTAGTTGTCCAATATGCTTTGG - Intergenic
1198027816 X:132725870-132725892 GGAACTGGGCCATTATGCTAAGG + Intronic
1198805724 X:140492238-140492260 GGAACTTGTCCAATTTGGAGAGG - Intergenic
1199369290 X:147026754-147026776 GGAACTTCTCCAACATGATAAGG - Intergenic
1201381549 Y:13385427-13385449 GAAAATTGTACAATATTCTAAGG - Intronic