ID: 1104406439

View in Genome Browser
Species Human (GRCh38)
Location 12:128521193-128521215
Sequence AGAGATAATCACTTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104406439_1104406442 -4 Left 1104406439 12:128521193-128521215 CCATCCTCAAAGTGATTATCTCT 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1104406442 12:128521212-128521234 CTCTGTTCTAAGAGACAGAAGGG 0: 1
1: 0
2: 2
3: 15
4: 274
1104406439_1104406441 -5 Left 1104406439 12:128521193-128521215 CCATCCTCAAAGTGATTATCTCT 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1104406441 12:128521211-128521233 TCTCTGTTCTAAGAGACAGAAGG 0: 1
1: 0
2: 2
3: 26
4: 261
1104406439_1104406443 22 Left 1104406439 12:128521193-128521215 CCATCCTCAAAGTGATTATCTCT 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1104406443 12:128521238-128521260 ACACATATTGTTATATATGCTGG 0: 1
1: 0
2: 0
3: 24
4: 278
1104406439_1104406444 27 Left 1104406439 12:128521193-128521215 CCATCCTCAAAGTGATTATCTCT 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1104406444 12:128521243-128521265 TATTGTTATATATGCTGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104406439 Original CRISPR AGAGATAATCACTTTGAGGA TGG (reversed) Intronic
901347542 1:8559607-8559629 AGAAATAATTACTTTCAGCAGGG + Intronic
902106088 1:14037322-14037344 AGAGGCAAACACTTTGAGTAAGG - Intergenic
902706969 1:18212344-18212366 AGAGATTATAACTTTGAGCTTGG - Intronic
905002508 1:34684144-34684166 AGAGACAATAACTCAGAGGAAGG - Intergenic
906007379 1:42487653-42487675 ATAAATAATGACTTTGAAGATGG + Intronic
906080075 1:43080484-43080506 AGAGAATAGCACTTTGGGGATGG + Intergenic
907403341 1:54238981-54239003 AGAGTTAATCACTTTTCTGACGG + Intronic
908051735 1:60240089-60240111 AGACATAAACAATTTGAAGATGG - Intergenic
908891194 1:68849990-68850012 AGAAATAATTAAATTGAGGATGG - Intergenic
912389848 1:109295389-109295411 AGAGATAATGGCTTTCTGGAAGG + Intronic
912392286 1:109311814-109311836 AGTGCTAACCACTTTGAGCAAGG - Exonic
913133199 1:115862014-115862036 AGAGATAATTTCTTAGAGAAAGG + Intergenic
913393766 1:118343483-118343505 AGAGATAAGCAGTTGAAGGAGGG - Intergenic
915878597 1:159641681-159641703 AGAGATTCTCAGTTTGAAGATGG - Intergenic
918230133 1:182521739-182521761 AGAGGCAATCTCTCTGAGGAAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919971346 1:202581474-202581496 AAAGAAAATCACTTTGAAGGGGG - Exonic
921446192 1:215249806-215249828 ATAGATAATTACTCTGAGTATGG - Intergenic
923130927 1:231074092-231074114 AGAGATAGGCACTTTGAAGGAGG - Intergenic
924178939 1:241421976-241421998 AGAGATAATGTATTTGGGGAAGG - Intergenic
1064375178 10:14789003-14789025 AGAGAAAATCGCTTTTAGGAAGG - Intergenic
1066269516 10:33808669-33808691 AGATATAATGACTTTCAGGCAGG + Intergenic
1066579765 10:36867437-36867459 TCAGATAATCACTTGGGGGATGG - Intergenic
1067666742 10:48285689-48285711 TGAGATAATTAAATTGAGGAGGG - Intergenic
1072478322 10:95785028-95785050 AGTGGAAATCACTTTGATGAGGG + Intronic
1073104998 10:101027449-101027471 AGAGGTACTCACTGGGAGGAAGG - Intronic
1074398146 10:113117348-113117370 AGAGAAAATCCCTTCAAGGAAGG - Intronic
1074410422 10:113223344-113223366 AGAGTTTAACTCTTTGAGGATGG - Intergenic
1074859925 10:117502414-117502436 ACAGATAACAACTTTCAGGAAGG - Intergenic
1076046568 10:127299056-127299078 AGATATAATCAGGTTGAGGTGGG + Intronic
1076248089 10:128963173-128963195 AGAAATAATGATTATGAGGAGGG + Intergenic
1076290387 10:129341124-129341146 AGAGCTACTCACTTCTAGGAAGG - Intergenic
1076642326 10:131927213-131927235 TGAGACAGTCATTTTGAGGAGGG + Intronic
1080196509 11:29616149-29616171 AGGGATAGTGACTTGGAGGAAGG - Intergenic
1080802933 11:35625421-35625443 GGAAAAAATCACTATGAGGAAGG - Intergenic
1081104280 11:39045850-39045872 AGAGTGCATCACTTTGTGGAAGG - Intergenic
1081353712 11:42087603-42087625 AGAGACAATCACTTCTAGCACGG + Intergenic
1084408965 11:68995065-68995087 AGAGATAATTCCTTTGGGAATGG + Intergenic
1085793103 11:79513028-79513050 GGAGATAATCACTTTGTTGCAGG + Intergenic
1085825545 11:79843142-79843164 AAAGATACTCATTTTGATGAGGG + Intergenic
1086040213 11:82467297-82467319 CGATATCATGACTTTGAGGATGG - Intergenic
1089571577 11:119414782-119414804 AGTGATCAGCACTATGAGGAGGG - Intergenic
1089827136 11:121288525-121288547 AGAGATAGGCACTTTGAAGAAGG + Intergenic
1089909983 11:122088386-122088408 AGAGAAAATGACTTCTAGGATGG + Intergenic
1090399475 11:126439929-126439951 AGGGATAAGTTCTTTGAGGAAGG + Intronic
1092489811 12:8934975-8934997 AGAGAGAATCACTTTCAATACGG - Intronic
1095443568 12:42261738-42261760 AGTGATAAATACTTTGAGAAGGG - Intronic
1096032393 12:48431660-48431682 AGAGATGATCACTTTCTCGAAGG - Intergenic
1097644996 12:62226006-62226028 AAACCTAAACACTTTGAGGATGG - Intronic
1097671184 12:62540674-62540696 AGAGATAATTTCTTTGAAAATGG + Intronic
1098562206 12:71887308-71887330 AGAGATAACCAGTGTAAGGAAGG + Intronic
1098754648 12:74345242-74345264 AGATTTAATCTCTCTGAGGAGGG + Intergenic
1098997556 12:77138377-77138399 CGAGATAAGTATTTTGAGGAAGG + Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1102154774 12:110715991-110716013 ATAGATGCTCACTTTGAGGTTGG + Intergenic
1104406439 12:128521193-128521215 AGAGATAATCACTTTGAGGATGG - Intronic
1106564772 13:30874655-30874677 AGAGAAAATTCCTGTGAGGAAGG - Intergenic
1108090471 13:46843997-46844019 AGAGAGAATTAATTTGGGGAAGG - Intronic
1109146234 13:58783155-58783177 AGAGAAAATAACATTTAGGAAGG + Intergenic
1112296326 13:98190399-98190421 AGAGTTAAAGACTTTGAGGTAGG - Intronic
1113159178 13:107360093-107360115 AGAAATAATTGCTTTGATGATGG + Intronic
1114413100 14:22518796-22518818 TGAGATAATCACTATGCAGAAGG + Intergenic
1114445740 14:22786590-22786612 AGATCTCATCACTTTGAGGTGGG - Intronic
1115357936 14:32468851-32468873 AGAAATAATAATTTTGATGAAGG - Intronic
1115405473 14:33010722-33010744 AGAGATAATCACTTGGGGTCAGG + Intronic
1115860962 14:37685966-37685988 AGTGGTAATCACTTGGAGTATGG + Intronic
1117211594 14:53506589-53506611 AGAGATAATCTCCTCTAGGAAGG + Intergenic
1117714115 14:58563268-58563290 AGAGAGAATTTCTTGGAGGAGGG + Intergenic
1118180500 14:63487787-63487809 TGAGATGATCAATGTGAGGATGG - Intronic
1119866472 14:77979192-77979214 AGGTACAATGACTTTGAGGATGG + Intergenic
1120077971 14:80181935-80181957 AGAGATAATAGCTTTGAAGCTGG + Intergenic
1121256485 14:92534139-92534161 AGATATAATCATTTTGTGGAGGG - Intronic
1124022987 15:25940738-25940760 ACAGAGAATCACCTTGAGGGAGG - Intergenic
1125194026 15:37026050-37026072 AAAAAAAATCACTGTGAGGAAGG + Intronic
1126705643 15:51402622-51402644 AGAGACAGTGACTTTGAGGGAGG + Intronic
1128806394 15:70534193-70534215 AGAGATATTCACAATGAGCATGG + Intergenic
1129409788 15:75343639-75343661 TTAGAAAATCACTTTGAGGCTGG + Intergenic
1130650366 15:85759075-85759097 GGAGAGAATCACTCTCAGGAGGG + Intergenic
1130679239 15:85981770-85981792 AGAGAGAACCACTTTGAAGACGG + Intergenic
1131946966 15:97632945-97632967 AGAGATAATGAATTTGTGCAAGG - Intergenic
1132001655 15:98186615-98186637 ATAGATAAGCACATTGAGGTTGG + Intergenic
1132227728 15:100155700-100155722 AGAGATAATCACTGTGCTAACGG + Intronic
1133194211 16:4157244-4157266 AGAGATAAAAACTTTGAAGAAGG + Intergenic
1133714278 16:8431938-8431960 AGAGAGAAGCACTTTGAAGGAGG + Intergenic
1138623546 16:58231130-58231152 AGAGTTATCCACTTTGATGAAGG - Intergenic
1142964399 17:3571788-3571810 AGAGATCACATCTTTGAGGATGG - Intronic
1143872607 17:9968000-9968022 AGAAAGAATGATTTTGAGGATGG + Intronic
1144172847 17:12676427-12676449 AGAGCTAATCATTTTGGGAATGG - Intronic
1146253728 17:31375611-31375633 AGATATAATGGCTTTGAGGGGGG + Exonic
1149116806 17:53107087-53107109 AGAGATAAGGTCTTTGGGGATGG - Intergenic
1149388508 17:56166467-56166489 AGAGATCATCCCATTGAGGGAGG - Intronic
1153301389 18:3595002-3595024 AGAGATAAAAGCTTTGAGGTGGG - Intronic
1153388649 18:4529964-4529986 AGAGATAATCACTTTCACCAAGG - Intergenic
1157021272 18:43785148-43785170 AAAGTTAATTACTTTGAGGATGG - Intergenic
1158031302 18:52968245-52968267 AGAGTTAATAACTCTGAGGAGGG + Intronic
1158590166 18:58772439-58772461 AAAGATAAACACTTTGAAGAGGG + Intergenic
1158726527 18:59978307-59978329 AGAGACAGGCACTTTGAAGAAGG + Intergenic
1159899880 18:74036226-74036248 AGAAATAAACACTTAGAGAAAGG + Intergenic
1161462964 19:4409749-4409771 GGAGATACTCACTCTGCGGAGGG - Exonic
1164428418 19:28165819-28165841 ATATATAATCAATTTGAGAAAGG - Intergenic
1167718671 19:51162001-51162023 AGAGACAAGCACTTTAAGGGAGG + Intergenic
1168438141 19:56338707-56338729 AGAGATGGTCACTTGGATGAGGG + Intronic
925483652 2:4304178-4304200 AGAGAGGATCACTTTGGGAAGGG + Intergenic
925594493 2:5541989-5542011 AAAGATAATCCCTTTCATGAGGG - Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
926323705 2:11766454-11766476 AGAAACAGACACTTTGAGGAAGG + Intronic
926366693 2:12139888-12139910 AGAGATATTCACTTTGAGAAGGG + Intergenic
927306246 2:21576736-21576758 AGATAAAGTCAGTTTGAGGAAGG + Intergenic
927306662 2:21581505-21581527 AGAAATAATGATGTTGAGGAAGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
929282844 2:40101418-40101440 AGAGCTAATCAGTTAGAGAAAGG + Intronic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
930003879 2:46881053-46881075 AGAGATAGTCACTTTCCAGATGG + Intergenic
930912408 2:56645124-56645146 AGAGAGAATCAATTCAAGGAAGG + Intergenic
931078849 2:58746244-58746266 AGAGACAATCACTATTAGGAAGG - Intergenic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
933148610 2:78887921-78887943 AGAGATAAGCACAATGAGAAAGG + Intergenic
933157252 2:78990077-78990099 AGAGACAGTCACTGTGAGAATGG - Intergenic
934933479 2:98446857-98446879 AAAAAAAATCACTTTAAGGAAGG + Intronic
935895109 2:107727806-107727828 AGAGAGAACCACTTTGAGCCAGG + Intergenic
937399163 2:121566751-121566773 AGAGGTAATGAGATTGAGGATGG - Intronic
939741449 2:145912334-145912356 AGAAATAGTCTCTTTGGGGATGG - Intergenic
939787548 2:146536377-146536399 AGAGCTCATCACCATGAGGATGG + Intergenic
940003136 2:148987103-148987125 AGAAAGAAGCACTTTGAGGATGG + Intronic
940682247 2:156801914-156801936 AGAGATAATGAATATCAGGAAGG + Intergenic
943022748 2:182595163-182595185 AGACATAATCAATTTAAGCAAGG + Intergenic
943032033 2:182697133-182697155 AGACATAATCACTTAAAAGATGG - Intergenic
943366148 2:186969475-186969497 AGAGAAAATCAGTCTGATGATGG + Intergenic
944245433 2:197525506-197525528 AGGGAGGATCACTTTGAGGTTGG + Intronic
945055886 2:205868704-205868726 GGAGAAAATCAAGTTGAGGAAGG + Intergenic
945590560 2:211724922-211724944 TGAGGGAATGACTTTGAGGAGGG + Intronic
946109672 2:217403543-217403565 AGAGAGACTCAGTTGGAGGAGGG - Intronic
1170754963 20:19193926-19193948 AGTGTTAATCACTTTTGGGATGG - Intergenic
1171341636 20:24433430-24433452 AGTGATAGGGACTTTGAGGAAGG + Intergenic
1171953778 20:31443589-31443611 AGAGATAATTAATGTGAGAAAGG - Intronic
1173968964 20:47136202-47136224 AGAGCTGATAAATTTGAGGATGG + Intronic
1177702601 21:24657852-24657874 GGAGAGAATCAGTTTTAGGAAGG - Intergenic
953903973 3:46859018-46859040 GGAAAAAATCACTTTGAAGAGGG + Intronic
955069711 3:55561906-55561928 AGAGATAGCCACTTTTATGATGG - Intronic
957372171 3:79309270-79309292 AGAACTAATCACTGTGAGGCTGG + Intronic
959409846 3:106007406-106007428 ACAGATATTCACTTTGAAAAGGG + Intergenic
960206130 3:114901395-114901417 AGAGGTAATAATTTTGATGATGG + Intronic
960670795 3:120153956-120153978 AGAGATAATCAAGTTAAGGTAGG + Intergenic
961421784 3:126811763-126811785 AGATAAAGTCCCTTTGAGGAAGG - Intronic
962154458 3:132930824-132930846 AGAGAAAATCACATTTGGGAAGG + Intergenic
962604550 3:137022886-137022908 AGAGACAGGCACTTTGAAGAAGG + Intergenic
963553234 3:146751785-146751807 AGAAATATTCTCTTTGAGCACGG - Intergenic
963910380 3:150812331-150812353 AGAGATGATTCCTTTGAGGCTGG - Intergenic
964808882 3:160641093-160641115 AGAGATAAGGGCTTTGAGTAGGG + Intergenic
964886718 3:161491940-161491962 AGAGCTAATCAGTATGAGGAAGG - Intergenic
965156498 3:165065353-165065375 AAATATAATCACTTGGAAGACGG + Exonic
966324371 3:178737873-178737895 CAAGATATTCACTTTGAAGAGGG + Intronic
968389169 4:174758-174780 AGAGATAATTTATTTGAGAAGGG - Intergenic
968791487 4:2666948-2666970 AGAAATAATCAATTTCAGAATGG - Intronic
970330319 4:14975931-14975953 AGAGAGAATTTATTTGAGGAAGG - Intergenic
970746712 4:19306995-19307017 ATATATACTCATTTTGAGGAAGG + Intergenic
971058559 4:22941015-22941037 AGAGTTACTCACTTTCATGATGG + Intergenic
971548814 4:27922472-27922494 AGAGATAATATTTTTGAAGATGG + Intergenic
973004164 4:44988751-44988773 AGAGGTAATCATTTTGAGGCTGG + Intergenic
975420801 4:74161893-74161915 AGAGATAATTAAGTTGTGGAAGG + Intronic
977817298 4:101429660-101429682 AGAGACAGGCACTTTGAGGGAGG + Intronic
978244137 4:106551841-106551863 ACAGAGAATCATTTTGAGGCAGG - Intergenic
978482979 4:109215828-109215850 AGAAAAGATCGCTTTGAGGAGGG - Intronic
978593670 4:110353945-110353967 AGAGATGAGCAAATTGAGGAGGG - Intergenic
979149292 4:117288351-117288373 AGATAGAATTGCTTTGAGGAAGG + Intergenic
979342070 4:119537067-119537089 AGAGATAAGGACCTTGAAGAGGG - Intronic
979360997 4:119764937-119764959 AGAGAGAATTACTTTGAAGAAGG + Intergenic
981834148 4:149035841-149035863 GGAGATAATAAGTTTGAGCATGG - Intergenic
981906833 4:149930773-149930795 ATAGAAACTCACTTTGAGTATGG + Intergenic
983370597 4:166852627-166852649 AGAAACAAACACTTTGAGGAAGG - Intronic
986377007 5:7142557-7142579 AAATATAATAACTTTTAGGAAGG - Intergenic
986550953 5:8955035-8955057 AGTGATAAGCAGTTTGAGAAAGG + Intergenic
986653663 5:9989602-9989624 AGAGAGGATCAGTTTTAGGAAGG + Intergenic
986808934 5:11335519-11335541 ATAAATAAGGACTTTGAGGATGG + Intronic
988451435 5:31347495-31347517 AAAGATAATTTCTATGAGGATGG - Intergenic
989736617 5:44715361-44715383 AGAGAGGAGCACTTTGAGGGAGG - Intergenic
990012286 5:51013850-51013872 AGAAATAATAACTTTGTGTAGGG - Intergenic
990193633 5:53289238-53289260 AGAGAGAATAACCTTGAGTAAGG + Intergenic
990270138 5:54128250-54128272 AGAGATAATCAGTTTGCTGCAGG - Intronic
990709616 5:58565467-58565489 TGAGATAAACACTTTGAGGGAGG - Intergenic
991623007 5:68565714-68565736 AAAGATCATCACGTTGAGGCGGG - Intergenic
992389709 5:76319060-76319082 AGGGAGAATCACTTTGTGAATGG + Intronic
993551879 5:89283213-89283235 AGATTTAATAAATTTGAGGATGG - Intergenic
994341932 5:98640151-98640173 AGAGATAAAGACTTTAATGAGGG - Intergenic
995381644 5:111541765-111541787 AGAGAAAATCTCTAAGAGGAGGG - Intergenic
997157707 5:131576891-131576913 AGAAATAATTTCCTTGAGGATGG - Intronic
1001069759 5:168575096-168575118 AAATATAAGCACTTTGATGATGG + Intronic
1004431957 6:15553262-15553284 AGACACAAACACTTTGAGGGAGG + Intronic
1004432092 6:15554586-15554608 AGACACAAACACTTTGAGGGAGG + Intronic
1004845913 6:19641775-19641797 AGACAAAAGCACTATGAGGAGGG + Intergenic
1006869277 6:37235879-37235901 AGAGATAGGGACTTTGGGGAAGG - Intronic
1007052389 6:38845714-38845736 AGAAATTATCACTTTGATGGAGG + Exonic
1010165294 6:72907342-72907364 ATAGAAAATCAATTTGAAGATGG - Intronic
1010201486 6:73285988-73286010 ATAAATAATCACATTTAGGAAGG + Intronic
1010708303 6:79140503-79140525 AGAAATAATCAGTATGAGAAAGG + Intergenic
1010989150 6:82459750-82459772 ATAGATAATTACTGTGTGGAAGG - Intergenic
1010993873 6:82511136-82511158 AGAGATGAAGACTTTAAGGAAGG + Intergenic
1011239076 6:85251537-85251559 AAGGATCCTCACTTTGAGGAAGG + Intergenic
1012088423 6:94859519-94859541 AGAGAAACTCACGTAGAGGAAGG - Intergenic
1013234548 6:108185874-108185896 AGAAATAATCACCTTCAGAAAGG - Intronic
1013237397 6:108209320-108209342 AGTGATTATGACTTTGGGGAAGG - Intergenic
1016405466 6:143725015-143725037 AGAGATAACCTCTTTGGAGAAGG - Intronic
1016455205 6:144223439-144223461 AGAAACAGACACTTTGAGGAAGG - Intergenic
1017479631 6:154838911-154838933 AGAAATAATCACTTAGTGAAGGG - Intronic
1019271357 7:150739-150761 AGAGAAAATTACTAAGAGGAAGG + Intergenic
1020599841 7:10259765-10259787 AGAGATAATAACATTAAAGATGG + Intergenic
1020817960 7:12929183-12929205 AGTTATAATCTCTTTGAGGATGG - Intergenic
1021575458 7:22101910-22101932 GGAGCAAATCTCTTTGAGGAAGG + Intergenic
1023306243 7:38831101-38831123 GAAGATATTCAATTTGAGGAAGG - Intronic
1028275581 7:88852705-88852727 TCAAATAATCACTTTGAGGACGG + Intronic
1028948532 7:96608023-96608045 AGATATAAACACTCTGATGATGG + Intronic
1028996747 7:97109375-97109397 AGAGATAAACACTATGAGCAGGG + Intergenic
1029304743 7:99610703-99610725 AGATAGAATCACTGTGAGTATGG - Intergenic
1029912818 7:104173375-104173397 AATGATAATCTATTTGAGGATGG - Intronic
1033454212 7:141487790-141487812 AGAGATAATCCTTGTGAGCAAGG - Intergenic
1034781047 7:153883207-153883229 AGAAAAAGTCATTTTGAGGATGG + Intergenic
1035639629 8:1174495-1174517 GGTGATAATGACTTTGATGATGG - Intergenic
1037114820 8:15211635-15211657 AGAGATGATCACATAGAAGAAGG - Intronic
1039656621 8:39415732-39415754 ACAGATAAAGACTTCGAGGAAGG + Intergenic
1040682543 8:49830934-49830956 AAAGGTAATGATTTTGAGGAAGG + Intergenic
1040917571 8:52579025-52579047 AAAGATAATTTCTTAGAGGAAGG + Intergenic
1041828426 8:62124885-62124907 AGAGATCTGCACTTTGTGGAAGG - Intergenic
1042990054 8:74629394-74629416 GCAGATAATTACTTTCAGGATGG + Intronic
1043023369 8:75034602-75034624 AAAGATAAGCTCTTTGAGAATGG + Intergenic
1044288990 8:90445698-90445720 AGACATAAGCATCTTGAGGACGG + Intergenic
1044828031 8:96217276-96217298 AGAAATAGTCACTTTGGGGCTGG - Intergenic
1045066083 8:98446126-98446148 GGAGAAAGGCACTTTGAGGAGGG - Intronic
1046017183 8:108618973-108618995 AGAGATCAACACTTTTAGAAAGG - Intronic
1048394101 8:133996894-133996916 AGAGTTAATAACTTTGGGGAGGG - Intergenic
1049333219 8:142066461-142066483 AGAGATAATCAATTTGAACATGG + Intergenic
1051092270 9:13424074-13424096 AGGGATCATGCCTTTGAGGAAGG - Intergenic
1051587695 9:18744488-18744510 AGAGATGATTATTGTGAGGATGG - Intronic
1055552886 9:77447299-77447321 AGAGAGAGTCACTGTGAGGTAGG - Intronic
1057884265 9:98817789-98817811 AGAAATAATGAGATTGAGGAGGG + Intronic
1058104022 9:100949777-100949799 AGAAATGATCAGATTGAGGAAGG + Intergenic
1058342698 9:103918352-103918374 AAAGACAATCACTTTGATGGAGG + Intergenic
1060325839 9:122614868-122614890 AGAGAGAATCAGTGTGATGATGG - Exonic
1060328286 9:122640250-122640272 AGAGATAACCACTTGGAGGGAGG - Intergenic
1060331183 9:122672286-122672308 AGAGATAGGCACTTTGAAGGAGG - Intergenic
1186955496 X:14677514-14677536 AGAAATTATCACCTTGGGGATGG + Intronic
1188872814 X:35394966-35394988 ATAGCTACTCACTTTAAGGAAGG + Intergenic
1189689642 X:43602611-43602633 AGAAATAGGCACTTTGAGGGAGG + Intergenic
1190535793 X:51426352-51426374 AGAAATAATCAATAAGAGGAAGG - Intergenic
1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG + Intergenic
1195701311 X:107707780-107707802 ACTGACAGTCACTTTGAGGAAGG - Intergenic
1196979522 X:121196084-121196106 TGAGATAGCCACTTTTAGGATGG + Intergenic
1197145896 X:123171945-123171967 AGAGATAATGACGTGGAGGCAGG + Intergenic
1197805059 X:130390714-130390736 AGAGTGAATAACTTTGAGGAGGG + Intergenic
1200898654 Y:8404311-8404333 AGAGAGAATCAGTTTGAAAAAGG - Intergenic