ID: 1104409494

View in Genome Browser
Species Human (GRCh38)
Location 12:128546473-128546495
Sequence CTGGAAGCTCAGAACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104409494_1104409504 18 Left 1104409494 12:128546473-128546495 CCCTGTTTGTTCTGAGCTTCCAG 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1104409504 12:128546514-128546536 AGTTGTGTTTGCTGTCTCAGTGG 0: 1
1: 0
2: 10
3: 122
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104409494 Original CRISPR CTGGAAGCTCAGAACAAACA GGG (reversed) Intronic
900900530 1:5512955-5512977 CTAGAAGCTGAGAACAAGCCTGG + Intergenic
902124037 1:14193508-14193530 CTGGAAGCTCATAATCAAGAAGG - Intergenic
902832599 1:19027140-19027162 ATGGAAACTCAGAAAATACAGGG + Intergenic
904646958 1:31974842-31974864 CTAGAAGCTGAGAAGAATCAGGG - Intergenic
906850752 1:49247583-49247605 CTGGAATCTCAGAAAAAAAAGGG - Intronic
907314834 1:53561669-53561691 CAGGAAGCTCAGAACATGCTGGG + Intronic
907771410 1:57468559-57468581 CTGGTGGCTCTGAACAGACAGGG + Intronic
908008522 1:59751958-59751980 CTGGAAGCTGAGGACATATAAGG + Intronic
908357264 1:63334928-63334950 CTTGATTCTCAGAACAAACCTGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
910502089 1:87904009-87904031 CTGGAATCTGAAGACAAACATGG - Intergenic
915152561 1:153846213-153846235 AAGGAAGCACAGAACAAGCAAGG - Intronic
916254172 1:162769466-162769488 CATGAAGCTCAGAACAAAGTAGG - Intronic
917257811 1:173134652-173134674 CAGGAAGCCCCAAACAAACAAGG + Intergenic
917604466 1:176612513-176612535 TGGGAAGCTCAGAACTAAAATGG - Intronic
917648714 1:177054591-177054613 ATGAAAGCTTTGAACAAACAGGG + Intronic
918052545 1:180987109-180987131 CTGGAGGCAGAGAACAAACCAGG - Intronic
920809276 1:209267159-209267181 CTGCAAGCTGAAAACAAATAAGG - Intergenic
922459025 1:225800653-225800675 CTGGGCGCTCAGAAGAACCAGGG - Intergenic
922540798 1:226417852-226417874 TTGGAAGTTAAGAGCAAACAAGG - Intergenic
924041733 1:239990630-239990652 ATGATGGCTCAGAACAAACATGG + Intergenic
1063182326 10:3615439-3615461 TTGGAAGCACAGAAGAAAGATGG - Intergenic
1063327899 10:5123340-5123362 CTGGTAGCACAGAGCAATCAGGG + Intronic
1067290098 10:44934053-44934075 TGGGAAGCTCAGACCACACATGG - Intronic
1069471584 10:68696517-68696539 TTGGAAGCCCAGAAGAAATAGGG - Intergenic
1072565826 10:96615864-96615886 GTGGAAGCTGTGCACAAACAGGG + Intronic
1072594696 10:96860447-96860469 CCGGAAGCTAGGAAGAAACAAGG + Intronic
1074897095 10:117786607-117786629 GTGGAAGCTCAGCTCCAACAAGG + Intergenic
1077905158 11:6526982-6527004 CTGCAACCTCAAAACACACATGG - Intronic
1079152078 11:17909015-17909037 CTGGAATCACAGAAAAAACCTGG + Intronic
1080373589 11:31681283-31681305 CTGGAAGGGCAGCAAAAACAGGG + Intronic
1081461562 11:43277044-43277066 CTGGAAGCTAGGAAGAGACAAGG + Intergenic
1085455500 11:76663112-76663134 CAGCGAGCTCAGAGCAAACAGGG + Intronic
1085716222 11:78875964-78875986 CCTGAGGCTCAGAACAAACAAGG - Intronic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1085977283 11:81673419-81673441 CTGAACACTCAAAACAAACATGG - Intergenic
1086957885 11:92952818-92952840 CTGAAAGCCCAGAAAAAACAGGG - Intergenic
1087094077 11:94303751-94303773 CTGAATGCTGAGCACAAACAAGG - Intergenic
1087130277 11:94663518-94663540 CTGGAAGCTAAGAGAAAGCACGG + Intergenic
1088192301 11:107239654-107239676 TTGGAAGTTCAGAACCAGCAGGG - Intergenic
1088431587 11:109765062-109765084 CCTGAAGCCCAGAACATACATGG - Intergenic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1091945832 12:4540472-4540494 CTGGCACCTCAGAACAATTAAGG + Intronic
1092064424 12:5578167-5578189 CTGGAAGCTCAGATCACAAGTGG + Intronic
1093400206 12:18737212-18737234 AGAAAAGCTCAGAACAAACAGGG + Intronic
1093419917 12:18963964-18963986 CAGGCAGCTCAGCACAGACAGGG - Intergenic
1093668513 12:21843870-21843892 CTGGAAAGTCAGAAAAGACAAGG + Intronic
1096468680 12:51863357-51863379 CTGGAAGGCCAGAACCTACACGG - Intergenic
1098342530 12:69467581-69467603 CTGGAATGTCAGAACAAATGAGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099486637 12:83236891-83236913 CTGGAAGATCAGAACAATTAAGG - Intergenic
1099600388 12:84728279-84728301 GTGGAAGTGCAGAACAAGCAAGG - Intergenic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101473853 12:105025164-105025186 CTGGAAGCTGAGCTAAAACAAGG + Intronic
1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG + Intergenic
1102489051 12:113277823-113277845 CTGCAAGTTCAGCTCAAACAGGG - Intronic
1102765962 12:115433251-115433273 CTGGAAGCTTAGAAGACACAGGG + Intergenic
1103106957 12:118236291-118236313 CTGAAAGATCAAAACAAACAAGG + Intronic
1104114409 12:125735473-125735495 CTGGAAGCTAGGAAGATACAAGG + Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1106127317 13:26911142-26911164 ATGGAAGCTGAGACCAAACATGG - Intergenic
1106762158 13:32877979-32878001 CAGGAGGCACAGAACAACCAAGG + Intergenic
1108348779 13:49571502-49571524 CTCGGAGCTCACAACATACAAGG + Intronic
1109106147 13:58253201-58253223 CAGGAAGATCAGCACAGACATGG - Intergenic
1111105024 13:83633965-83633987 CTGGAAGCCCATGAGAAACATGG - Intergenic
1111410854 13:87874725-87874747 CTGGAATGTCTGAACAATCAAGG - Intergenic
1111705754 13:91747405-91747427 CAGTAAGCTCAGGGCAAACAAGG + Intronic
1112634192 13:101196901-101196923 CAGGAAGCTCAGGATAAAGAGGG - Intronic
1116293671 14:43075341-43075363 CTGGAAGCTCAGTACAATTGCGG - Intergenic
1116748445 14:48850873-48850895 CTGGAATTTCAGAACAGAAAAGG - Intergenic
1118853803 14:69605782-69605804 CTGGCAGCTCAGAGCTAGCAAGG + Intergenic
1119048909 14:71346479-71346501 CATGAAGCTCAGAGCAAAGATGG + Intronic
1119944534 14:78678752-78678774 CTGGATTCTCAGTAGAAACAAGG - Intronic
1120162553 14:81161454-81161476 CTGAAAGGACAGAAAAAACAGGG - Intergenic
1120579538 14:86228793-86228815 CTGGAAGAGCAGAACAAAGTTGG - Intergenic
1123218014 14:106830729-106830751 GGGGGAGCTCAGAACCAACAGGG - Intergenic
1128713816 15:69892521-69892543 CAGGAAGCTCAGAACAAATTAGG + Intergenic
1130050441 15:80479713-80479735 CTGAAGGCTCAGCAGAAACAGGG + Intronic
1130108979 15:80949546-80949568 CTGGAATCTCAGAACTAAAAGGG - Exonic
1130651602 15:85765080-85765102 CTGGAGGCTCAGACCAGAGATGG + Intronic
1131314983 15:91328319-91328341 CTGGCAGCTCATCACAAACAAGG - Intergenic
1132223769 15:100125095-100125117 CAGGACGCTCAGTACAAACCTGG + Intronic
1134562591 16:15223464-15223486 TTGGGAGCTCAGAATAGACACGG - Intergenic
1134923131 16:18135091-18135113 TTGGGAGCTCAGAATAGACACGG - Intergenic
1135036426 16:19081882-19081904 GCTGAAGCTCAGAAGAAACAAGG + Intergenic
1135377220 16:21957828-21957850 CTGGAAGCTAGGAACAGGCAGGG - Intronic
1137605008 16:49781397-49781419 CAGGAAGCTCAGGTCCAACAGGG + Intronic
1138339290 16:56278305-56278327 CAGGAAGCTCACACCAGACAAGG - Intronic
1139309445 16:66016142-66016164 CTGGAAGCTGAAAAAAAGCAAGG - Intergenic
1140260310 16:73372656-73372678 CTGGCTGCTCAGAATAACCATGG + Intergenic
1140289633 16:73641013-73641035 CTGGAAGCTCAAAGACAACAGGG + Intergenic
1140896110 16:79325802-79325824 CAGAAAGAGCAGAACAAACATGG + Intergenic
1141383805 16:83600863-83600885 CTGGAATCTCAGAAAAGAAATGG - Intronic
1142919693 17:3173189-3173211 CAGGAAGCTCAGCACAGAGAAGG + Intergenic
1144671734 17:17136601-17136623 CGGGAATCTCAGAACATACCAGG - Intronic
1145045030 17:19607037-19607059 CTGTAAGCTCACCACTAACAGGG - Intergenic
1145736196 17:27233487-27233509 CAAGAAGCTCAGAGCAAAGACGG + Intergenic
1148581574 17:48747505-48747527 CTGGAGGCCCAGGAGAAACACGG - Intergenic
1152359622 17:79825578-79825600 CTGGAAGCTCAGAACAGAGAGGG - Intergenic
1153016252 18:584845-584867 CTGGGAGCTCAGACCACTCAGGG - Intergenic
1153515541 18:5897202-5897224 CTGGAAGTTCAGAGCCAAAAAGG - Intergenic
1155031646 18:21990221-21990243 CTGGAAGCTCAGAGAAGAGACGG - Intergenic
1155694944 18:28674279-28674301 CTGGCAGCTAAGAAAAAAAAGGG - Intergenic
1155868156 18:30992349-30992371 CTGGTTGTGCAGAACAAACAAGG - Exonic
1156307081 18:35887408-35887430 CTGGAACCTCAGAACACTCCTGG + Intergenic
1159424932 18:68272739-68272761 CTGGAAGCTCACAAACAACGAGG - Intergenic
1162893178 19:13748452-13748474 CCGTAAGCCCAGGACAAACAGGG + Intronic
1167071053 19:47222096-47222118 CTGGAGGCAGAGGACAAACACGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168579651 19:57544305-57544327 CTGGAAGCTAAGAAAAACCTAGG + Exonic
1202660016 1_KI270708v1_random:60038-60060 CTCAAAGGTCACAACAAACAGGG - Intergenic
925820269 2:7793185-7793207 CTGGTCTCTCAGAACACACACGG - Intergenic
926496696 2:13597840-13597862 TTGGATGCTCAGGAGAAACATGG + Intergenic
927094660 2:19738542-19738564 CTGGAAGCTGAGAACAGACCTGG - Intergenic
931476016 2:62588337-62588359 CTGTAAGCTCAAAACTAAAATGG + Intergenic
932360408 2:71100698-71100720 TTGGAACCTCAGCAAAAACATGG + Intergenic
932635576 2:73385599-73385621 CTGTAAGCTCACAATAAACCGGG - Intergenic
933411901 2:81936420-81936442 CTGTAAGCTCAGAAGATATAAGG - Intergenic
935237046 2:101148219-101148241 CAGGAAGCTGAGAAGAGACAGGG + Intronic
935406119 2:102711390-102711412 CTCGTGGCTCAGAACACACAAGG + Intergenic
936236735 2:110748569-110748591 CTGCAAGCTCTGAACCAGCAAGG - Intronic
936348601 2:111695000-111695022 CTAGAAGCTCAGAATAAACCTGG - Intergenic
938599656 2:132824081-132824103 CTTGAAGTTCAGAATAAATAAGG + Intronic
940016865 2:149115662-149115684 CTGGAAGCTAAGATAACACATGG + Intronic
940023710 2:149182670-149182692 GTGGATGCTCACAACCAACAAGG + Intronic
940779797 2:157920571-157920593 CTGGAAGCTCAGAGCCTACTTGG - Intronic
941372397 2:164681658-164681680 CTGGAAACTAAGAATAAACTGGG + Intronic
941857224 2:170243326-170243348 CTGGAAGATAAGAAACAACATGG - Intronic
942691329 2:178588506-178588528 CTGTAATATCAGAAAAAACAAGG + Intronic
945054088 2:205852792-205852814 GTGGAAGCTCGAAAAAAACAAGG + Intergenic
945184137 2:207122634-207122656 CTGGAAAATCAGAACAACCTGGG - Intronic
948682776 2:239647659-239647681 CTTAAAGCTCAGAACATGCAAGG - Intergenic
948944447 2:241212358-241212380 CTGGCACCTCTGAGCAAACAGGG + Intronic
949074051 2:242044047-242044069 GTGCAAGCTGAGAACAAACGTGG - Intergenic
1170375208 20:15692593-15692615 CTGGAAGCGCAGAGAAAAGAAGG + Intronic
1172012665 20:31855236-31855258 TTCGAAGCTCAGGTCAAACAAGG - Intronic
1173573268 20:44092349-44092371 CAGGAAGCTCAAAACTAACTGGG + Intergenic
1178899155 21:36585097-36585119 CAGGAAGAACAGAGCAAACATGG + Intergenic
1179016645 21:37599779-37599801 CTGGAAGCCCATAACATAAACGG - Intergenic
1179780147 21:43694358-43694380 CTGTAAGTTCATTACAAACACGG + Exonic
1180327493 22:11443619-11443641 CTCAAAGGTCACAACAAACAGGG - Intergenic
1180366946 22:11948916-11948938 CTGAAAGGTCACAACCAACAGGG + Intergenic
1180745858 22:18088430-18088452 CTGGAAGTTCAGAAAAAGCCTGG + Exonic
1180783760 22:18535726-18535748 TTGGAACCTCAGAGCAGACAGGG - Intergenic
1180889223 22:19273567-19273589 CAGCAAGCACAGAAAAAACAAGG + Intronic
1181127329 22:20709775-20709797 TTGGAACCTCAGAGCAGACAGGG - Intronic
1181240661 22:21475078-21475100 TTGGAACCTCAGAGCAGACAGGG - Intergenic
1181846193 22:25711045-25711067 CTGGAAGATCCAAACAAGCATGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1183498502 22:38164022-38164044 CTGGTATCTCAGCAGAAACAGGG - Intronic
949451190 3:4187050-4187072 TTGGCAGCTCAGAAGATACATGG - Intronic
951071449 3:18333528-18333550 TTGAAACCTCATAACAAACATGG - Intronic
952843640 3:37668745-37668767 CAGGTGGCTCAGAACAAACTTGG - Intronic
954183444 3:48899080-48899102 ATGGGAGCTCAGAGGAAACATGG - Intergenic
961462764 3:127063125-127063147 CGGGGAGCTCAGAGCAAAGACGG - Intergenic
962298595 3:134216410-134216432 CTGAAAGCACAGAACAGCCATGG + Intronic
962729617 3:138268300-138268322 CAGGAATCTTGGAACAAACAGGG + Intronic
963742619 3:149095759-149095781 CTTGAAGCTCAGAATACCCAAGG - Intergenic
964417357 3:156461325-156461347 CTGGAAGCTAAGAGGAAGCAAGG - Intronic
964508283 3:157422797-157422819 CAGGAAGTTTAGAAAAAACAAGG - Intronic
964716054 3:159723026-159723048 CTGGAAGCACTGAGCACACATGG - Intronic
965417759 3:168418244-168418266 CTGGAAGCTCACAGAACACAGGG + Intergenic
965690391 3:171350280-171350302 CTGGTAGCCAAGAACAAACCTGG + Intronic
967294991 3:187955849-187955871 CTGAAACTACAGAACAAACATGG - Intergenic
970012759 4:11478533-11478555 CTGGAAGCTGGGAAGAAAGACGG - Intergenic
970158529 4:13165948-13165970 GTGGAAGTTCAGAGCAATCAAGG + Intergenic
976444222 4:85111239-85111261 CAGGCAGCTCAGCACAGACAGGG + Intergenic
976555319 4:86444221-86444243 CAGGAAGCTCAGAAAATACCAGG + Intronic
976867007 4:89741096-89741118 TTGGAAGCTCAGGAGAAAAAGGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
981723908 4:147828349-147828371 CTGGTGGCTCAAAACCAACAGGG - Intronic
984316329 4:178137037-178137059 CTGGAAGCACAGAACACTGAGGG + Intergenic
984325050 4:178241433-178241455 GTGGGAGCTGAGAACAAGCAAGG + Intergenic
985619133 5:944481-944503 CTGGAAGCACAGGGCACACAAGG - Intergenic
985993431 5:3582702-3582724 TTGGAAGCTCAGAAACCACATGG - Intergenic
988102695 5:26702358-26702380 CTAGAGGGACAGAACAAACAGGG - Intergenic
990432408 5:55749209-55749231 CTGGGAGTTCAGAACCAGCATGG + Intronic
990559446 5:56969068-56969090 CAGGAAGATCAGAACAAAGAAGG - Intronic
992853860 5:80840067-80840089 CTGGAAGCTGAGAAGAAGAACGG - Intronic
993715952 5:91276057-91276079 CTGGAAGCTAGGAAGATACAAGG + Intergenic
994156791 5:96513014-96513036 CTGAAACCACAGAACAATCATGG + Intergenic
995199131 5:109407495-109407517 CTGATAGCTAACAACAAACATGG - Intronic
996685218 5:126272525-126272547 CTTGCAGCTCAGTACAGACAGGG - Intergenic
998502004 5:142641289-142641311 CAGAAATCTCAGATCAAACAAGG - Intronic
999168486 5:149571993-149572015 CTGGAAAATAAGAACAAACTTGG + Intronic
1000502102 5:162064853-162064875 ATGAAAGCTCAAAAGAAACAGGG - Intergenic
1000642099 5:163715288-163715310 CTTGAAGCTTAGAACAGACAAGG - Intergenic
1000699717 5:164433696-164433718 CTGGAAACTCAGAACATACCAGG - Intergenic
1001415658 5:171543389-171543411 CTGGAACCCCAAACCAAACATGG + Intergenic
1001644277 5:173268754-173268776 CTGGAAGCTCAGAATTTTCATGG + Intergenic
1002341561 5:178519517-178519539 CTGGGAGATCAGACCACACAGGG - Intronic
1002357286 5:178641148-178641170 CTAGAGGCTTAGAACACACAGGG - Intergenic
1002407534 5:179047604-179047626 CTGAAAGCCAAGAACAGACAAGG - Intergenic
1004741516 6:18465665-18465687 CTTGAAGCTGAGATCACACAAGG - Exonic
1006410154 6:33868832-33868854 CTGGCAGCTCAGAAGAACCTGGG - Intergenic
1006429900 6:33989019-33989041 CTGGAAGGTAAGAACAAGGAGGG - Intergenic
1007723701 6:43901375-43901397 CAGGGAGCAGAGAACAAACAGGG + Intergenic
1008370386 6:50724219-50724241 ATGCAACCGCAGAACAAACAGGG + Intronic
1008405947 6:51118611-51118633 CTTGTGGCTCAGAACAAATATGG + Intergenic
1010311494 6:74391189-74391211 CTGGAAGCTAAAAAAAGACAAGG - Intergenic
1010536134 6:77033460-77033482 TAGGAAGCTCAGAGGAAACATGG + Intergenic
1013211522 6:107991052-107991074 CTTCAATCTCAGAACAACCAAGG - Intergenic
1014542311 6:122692051-122692073 CAGGCAGCTCAGCACAGACAGGG - Intronic
1014623439 6:123697708-123697730 CTTGAAGCTCAGAATAGATAGGG + Intergenic
1016672799 6:146728401-146728423 CTGTAGTCTCAGAAAAAACAAGG - Intronic
1016757137 6:147699041-147699063 TTGGAGGCTCAGGCCAAACATGG + Intronic
1017002331 6:150005116-150005138 CGGGAAGCACAGAAGAAACGCGG + Intergenic
1018861994 6:167717722-167717744 GTGGAAGCACATAACACACACGG + Intergenic
1019296561 7:279954-279976 TGGGAAGCTCAGAACTGACAAGG - Intergenic
1019568551 7:1697085-1697107 CGCGAAGCCCAGATCAAACAGGG - Intronic
1021088458 7:16451997-16452019 CTGGAAGGTGAGAGCACACAGGG - Intergenic
1025302223 7:57826928-57826950 ATGGTAGCTCATAATAAACAGGG + Intergenic
1027806446 7:82831196-82831218 CTTGAAGCTCAGAAAAATTAAGG + Intronic
1028966205 7:96804480-96804502 CAGGAAGCTCAGAATCAAAATGG + Intergenic
1030041187 7:105451641-105451663 ATGGGAGCACATAACAAACATGG - Intronic
1030251833 7:107454746-107454768 GTTGAAGCTCAGAAAAGACATGG + Intronic
1030414379 7:109222631-109222653 CTGAAAGGTCAGCACAAAAATGG + Intergenic
1032298439 7:130664483-130664505 CTTGAAACTCAGAAAACACATGG + Intronic
1032848678 7:135773651-135773673 ATGCAAGCTGAGAACAAACACGG + Intergenic
1034702649 7:153109717-153109739 CTGGATGCCAAGAACAACCATGG - Intergenic
1036523974 8:9518284-9518306 TTGGAAGCACAGGAGAAACAAGG + Intergenic
1037129799 8:15393930-15393952 CTAGAAGCTTAGAACTAAAAGGG + Intergenic
1038141670 8:24851694-24851716 CTGGATGCTGAGAACTCACAAGG + Intergenic
1038977060 8:32711053-32711075 CTTGTAGCTAAAAACAAACAAGG - Intronic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1040464017 8:47678097-47678119 CTGGGAGCATAGTACAAACAGGG - Intronic
1043072805 8:75660765-75660787 CAAGGTGCTCAGAACAAACAGGG + Intergenic
1043184662 8:77131812-77131834 ATGGAAGCTCAGAGAAGACAAGG + Intergenic
1043260589 8:78190323-78190345 CTGAAAGCTGACAACAAGCATGG - Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044130450 8:88517224-88517246 CTTGAAGCTCAGAAGAAAATAGG - Intergenic
1048278978 8:133090753-133090775 CTGGAAGCTCAGAAAGACAAAGG + Intronic
1048289908 8:133172990-133173012 CCAGAAGCTCAGAACCAACCTGG + Intergenic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1052878099 9:33582389-33582411 CTGTAAGATCATAACAAAAAGGG - Intergenic
1053497884 9:38561820-38561842 CTGTAAGATCATAACAAAAAGGG + Intronic
1053972187 9:43752477-43752499 CTGGTAGTTGAGAACACACATGG - Intergenic
1053995038 9:44147791-44147813 CTGGTAGTTGAGAACACACATGG - Intergenic
1054012335 9:44449676-44449698 CTGTTAGCTGAGAACACACATGG - Intergenic
1054036204 9:44859729-44859751 CTGTTAGTTCAGAACACACATGG - Intergenic
1054040048 9:44925186-44925208 CTGTTAGTTCAGAACACACATGG - Intergenic
1055560795 9:77519718-77519740 CTGAAAGCCCAGACCAGACATGG + Intronic
1058539384 9:105995695-105995717 CTGGAATCTCAGAAAAAGAAAGG + Intergenic
1059516925 9:114904542-114904564 CTGGAGGTTCAGAACACACATGG + Intronic
1059572815 9:115458778-115458800 TTGCAAGATCAGAACAAACAGGG - Intergenic
1061370339 9:130194151-130194173 ATTGAAGCTCAGCTCAAACATGG - Intronic
1062654132 9:137593450-137593472 CTAGAAGCTGAGAACAACCCCGG - Intergenic
1185854494 X:3521387-3521409 GGGGAAGAACAGAACAAACATGG - Intergenic
1187069559 X:15874668-15874690 CTGGAGGCTCTTTACAAACAGGG + Intergenic
1187331341 X:18342759-18342781 CTAGAAGCTCTGAACAAGTATGG + Intronic
1188655699 X:32692645-32692667 CAGCAACCTCAGAACAAAAAAGG + Intronic
1189203561 X:39218570-39218592 GTGGAATCTAAGAAGAAACAAGG - Intergenic
1190908208 X:54749001-54749023 CAGGAATCACAAAACAAACATGG - Exonic
1191600538 X:63000716-63000738 CTGCAAGTTCAGAGCCAACATGG + Intergenic
1192018216 X:67355137-67355159 CTGGAAGATTAGAAAAAATATGG - Intergenic
1193526097 X:82591425-82591447 CTTGAATCTAAGAACTAACAGGG - Intergenic
1193668801 X:84357722-84357744 CTGGAAGGTGAGGACAAATATGG - Intronic
1194918911 X:99739812-99739834 GTGCAAGCTCTGAACAAACTTGG - Intergenic
1197043296 X:121966445-121966467 CTGGAATTTCAGGACAAACCAGG - Intergenic
1199135150 X:144241367-144241389 CTGAAAGCTCAAAACAATCACGG - Intergenic
1200692727 Y:6323336-6323358 ATGGATTCTCAGAACAAATAAGG - Intergenic
1200809019 Y:7463136-7463158 GGGGAAGAACAGAACAAACATGG + Intergenic
1201042546 Y:9851390-9851412 ATGGATTCTCAGAACAAATAAGG + Intergenic
1201343750 Y:12960340-12960362 CTGTCACTTCAGAACAAACAAGG + Intergenic
1201412615 Y:13715935-13715957 GTGCAAGCTCAGACCAAAGAAGG - Intergenic
1201497904 Y:14609276-14609298 TTGGAAAATCAGCACAAACAAGG - Intronic
1202112848 Y:21442537-21442559 ATGGATTCTCAGTACAAACATGG + Intergenic