ID: 1104410613

View in Genome Browser
Species Human (GRCh38)
Location 12:128554656-128554678
Sequence CTCGACTGTGCCTCTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104410609_1104410613 15 Left 1104410609 12:128554618-128554640 CCAGGTACAGAGTTTGCAGCAAA 0: 1
1: 0
2: 0
3: 20
4: 172
Right 1104410613 12:128554656-128554678 CTCGACTGTGCCTCTTTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1104410608_1104410613 25 Left 1104410608 12:128554608-128554630 CCTGTATTGTCCAGGTACAGAGT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1104410613 12:128554656-128554678 CTCGACTGTGCCTCTTTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104410613 Original CRISPR CTCGACTGTGCCTCTTTTGG AGG Intronic
900713148 1:4127723-4127745 CTCTACTGTTCATCTTTGGGTGG + Intergenic
903006820 1:20304067-20304089 CTGGACTGTGCTTGGTTTGGAGG - Intronic
903148888 1:21391133-21391155 CTCAAGTTTCCCTCTTTTGGGGG - Intergenic
908828270 1:68154132-68154154 CTCAAATGTGGCTTTTTTGGGGG - Intronic
909259367 1:73467531-73467553 CTAGATTATGCCTCTTGTGGAGG + Intergenic
910639899 1:89447758-89447780 CTCTTCAGTGCCTCTTTTAGTGG + Intergenic
921113780 1:212066374-212066396 CTCCACTGGGCCTCTTTTTCAGG + Intronic
923274877 1:232387127-232387149 CTCCTCTGTGCCTCTTTTCAGGG + Intergenic
1063353332 10:5375474-5375496 TTTGACTTTGCCTCTGTTGGTGG - Intergenic
1068314180 10:55320210-55320232 CTCCACTGTGCCACTGTTGCTGG + Intronic
1068708120 10:60099929-60099951 CTCTACTGTGCCTGATATGGGGG + Intronic
1070383666 10:75904093-75904115 CTAGACTGTGTCTCTTTGGCTGG + Intronic
1072627975 10:97126408-97126430 TTGGACTCTGCCACTTTTGGTGG - Intronic
1074449030 10:113544290-113544312 CTGGGCTGTGCCACATTTGGAGG + Intergenic
1079249109 11:18774278-18774300 CTCTGCTGTGCCTTTGTTGGTGG - Intronic
1085789650 11:79486016-79486038 CTGAACTGAGCCTTTTTTGGTGG + Intergenic
1086294227 11:85347127-85347149 TTCCACTTTGCCACTTTTGGGGG + Intronic
1086988431 11:93275776-93275798 CTTGAATGTGCCTCTTATGGAGG - Intergenic
1095140540 12:38657223-38657245 CTCTCCTGTGCCTGGTTTGGTGG + Intronic
1095746067 12:45660417-45660439 CGCAACTGGTCCTCTTTTGGAGG - Intergenic
1099588388 12:84551467-84551489 CTTGACTGTGCCTCTCCTGGTGG + Intergenic
1104410613 12:128554656-128554678 CTCGACTGTGCCTCTTTTGGAGG + Intronic
1109922353 13:69082329-69082351 CTCTACTGTGTCACTTTGGGAGG - Intergenic
1110063277 13:71068136-71068158 CTGGACTGTGCCACTCTTTGTGG - Intergenic
1110291180 13:73808317-73808339 CCCGACTGTGGGTCTCTTGGTGG + Intronic
1112904203 13:104397119-104397141 CTCGTCTCTGCCTCCTTTTGTGG + Intergenic
1113005874 13:105701607-105701629 CACGACTTTGCTTTTTTTGGGGG + Intergenic
1118357722 14:65028863-65028885 CAAGACTGTGCATATTTTGGGGG - Intronic
1118752476 14:68816885-68816907 CACGTCTGGGCCCCTTTTGGGGG + Intergenic
1119514435 14:75236893-75236915 TTTAACTGTGCATCTTTTGGGGG + Intergenic
1123687633 15:22810551-22810573 CTTGACTTTGCCACTTTCGGTGG + Intronic
1123951924 15:25287661-25287683 CTGAGCTGTGCCACTTTTGGGGG - Intergenic
1124278313 15:28344125-28344147 CTCTGCTGTGCCCCTTTTTGGGG + Intergenic
1124304389 15:28567483-28567505 CTCTGCTGTGCCCCTTTTTGGGG - Intergenic
1124341747 15:28894418-28894440 CCAGACTGTGCCTCTCTAGGAGG - Intronic
1124533264 15:30523950-30523972 CTCTGCTGTGCCCCTTTTTGGGG - Intergenic
1124765393 15:32483694-32483716 CTCTGCTGTGCCCCTTTTTGGGG + Intergenic
1124965430 15:34429549-34429571 CCAGACTGTGCCTCTCTAGGAGG + Intronic
1125131844 15:36290982-36291004 TTCCACTGTGTCTCTTTTGGTGG + Intergenic
1130183991 15:81661513-81661535 CTCTACAGTGCCTTTCTTGGGGG + Intergenic
1130188292 15:81707383-81707405 CTCTACAGTGCCTTTCTTGGGGG + Intergenic
1133085932 16:3363559-3363581 ATCGACCATTCCTCTTTTGGTGG - Intergenic
1136041603 16:27583859-27583881 CTTGACTCTGCCTTCTTTGGTGG + Intronic
1137686617 16:50391090-50391112 CTCGGCCGCGCCTCTTTTGTGGG - Intergenic
1138008260 16:53356842-53356864 CTCTCCTGTGCCCCTTTTTGGGG + Intergenic
1148617615 17:49013077-49013099 CTCAACTCAGCCTCTTGTGGTGG + Intronic
1149467801 17:56893441-56893463 CTGGTCTGGGCCTCTCTTGGGGG + Intronic
1150670329 17:67190618-67190640 CTTTTCAGTGCCTCTTTTGGAGG - Intronic
1151229945 17:72677306-72677328 CTCCTGTGTGCCTCTTTTGCTGG - Intronic
1153584416 18:6606596-6606618 CTCCATGGTGCCTCCTTTGGGGG - Intergenic
1161050841 19:2163565-2163587 CTGGACCGTGACTCTTATGGGGG + Intronic
1161750472 19:6092599-6092621 CTCGCGTGTGCCTCTTGGGGAGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1167268933 19:48497593-48497615 CTCGGCTGTGCCTCCGGTGGCGG + Exonic
926972569 2:18481687-18481709 CTAGACTGTGGCTTCTTTGGAGG - Intergenic
927891323 2:26751619-26751641 CTGAACTGTGCTTCTTCTGGAGG - Intergenic
928908650 2:36395816-36395838 CTCCATTGTAACTCTTTTGGTGG + Intronic
930726774 2:54689363-54689385 CTCGAATGTGGTCCTTTTGGTGG - Intergenic
930897366 2:56461961-56461983 CTGGCCTGTTTCTCTTTTGGTGG + Intergenic
936890224 2:117360474-117360496 CTCAGCTGTGCCTGTTGTGGTGG - Intergenic
938241878 2:129748436-129748458 CAGGCCTGTGCCTCTTGTGGGGG - Intergenic
939128964 2:138211651-138211673 CTTGACTGTGCTTCTCTGGGGGG + Intergenic
940799324 2:158115952-158115974 CCTGCCTGTGCCTCTTTTGAGGG - Intronic
940849701 2:158676455-158676477 CTACACTGTGCCTCTTTAGCCGG + Intronic
947633008 2:231665860-231665882 CTTGAATGTGGCTCCTTTGGAGG - Intergenic
948602014 2:239112622-239112644 CTCCACTCTGCCTCGTATGGGGG - Intronic
1170093465 20:12617867-12617889 TTAGACTGTGGCTGTTTTGGAGG - Intergenic
1175148894 20:56917446-56917468 CTCAACTCTGCCTGCTTTGGAGG + Intergenic
1178075083 21:29007943-29007965 CTGGACTGTGCTTCCTGTGGTGG + Exonic
1179643207 21:42760515-42760537 CACGCCTGTGGCTCTCTTGGTGG - Intronic
1184273438 22:43397575-43397597 ATCACCTGTGCCTCTTTTGCTGG + Intergenic
1184928332 22:47660164-47660186 CTCCACTCTGCCTCTCTTCGAGG + Intergenic
950012435 3:9732543-9732565 CTCGCCTGTGCCTCTGCTGCCGG + Intronic
953118698 3:40018091-40018113 GTTGCCTGTCCCTCTTTTGGAGG + Intronic
954275106 3:49536796-49536818 CTCTGCCCTGCCTCTTTTGGGGG + Intergenic
955386474 3:58485087-58485109 CTCCACTCTGCCTCTCTTGGTGG - Intergenic
956934020 3:74079189-74079211 CTTCACTGTGCCTCCATTGGTGG - Intergenic
959721051 3:109489743-109489765 CTGGACTGTGCTTCGTTTGAAGG + Intergenic
960172541 3:114479049-114479071 CTGGTCTGTTCCTCTATTGGGGG + Intronic
974172850 4:58290566-58290588 ATGTACTGTGCCTCTTTTGAGGG + Intergenic
976129112 4:81865722-81865744 CTGGACTGTGACTCTTTAAGGGG + Intronic
980172551 4:129306736-129306758 CTCCTCAATGCCTCTTTTGGAGG + Intergenic
981482121 4:145249709-145249731 CCTGAGTGTGCATCTTTTGGTGG + Intergenic
990343916 5:54852551-54852573 CTTTACTGTGCTTTTTTTGGGGG - Intergenic
991444010 5:66680739-66680761 CTCGGGTTTGCCTTTTTTGGGGG - Intronic
994021409 5:95030050-95030072 CTCGCCTGAGCCCATTTTGGTGG + Intronic
994643721 5:102443442-102443464 CTAGTCAGTTCCTCTTTTGGGGG - Intronic
997385629 5:133469869-133469891 CTTGACTGTGCCTCTGAGGGAGG - Intronic
997792763 5:136776689-136776711 CTCTGCTGGGCCTCTTTTGTTGG + Intergenic
999902694 5:156102939-156102961 CACGATTTTGCCTCTTTTGAAGG - Intronic
1001170883 5:169417906-169417928 CTCCACTGTGACTCCTTAGGCGG - Intergenic
1001958300 5:175863551-175863573 ATCGACTGAGCCTCTCATGGGGG - Intronic
1002906389 6:1452567-1452589 CTCTACTGTGTCTCACTTGGAGG + Intergenic
1004240209 6:13914542-13914564 CTCATCTGTGCTTCTTTTGTGGG - Intergenic
1005522397 6:26612649-26612671 CTCTTCTGTGCCTTTTTTAGGGG + Intergenic
1007494580 6:42250837-42250859 CTGGACTGTGGCTAATTTGGGGG + Intronic
1007643793 6:43364991-43365013 CTCAACTGTTCTTCATTTGGGGG + Intronic
1008306447 6:49907505-49907527 CTCTGCTGGGCCTCTTTTGACGG + Intergenic
1008371172 6:50732571-50732593 CTTGACTCTGCCTCTTTGTGGGG + Intronic
1008888742 6:56460346-56460368 CTCTACTATTCCTCTTTAGGAGG + Intronic
1017230859 6:152072105-152072127 CCTGACTGTGGCTCTTTTAGAGG - Intronic
1017954557 6:159167972-159167994 CCCGGCTCTGCCTATTTTGGGGG - Intergenic
1022284494 7:28942117-28942139 CTGGACTGTGCCTCTTTTTCTGG + Intergenic
1024234591 7:47388354-47388376 CTTGACTGTTCTTCTGTTGGTGG - Intronic
1026678015 7:72444602-72444624 CTGGACTGTGCCTTTTCTGAGGG - Intronic
1035587531 8:787459-787481 CACGCCTGTGCCTGTTTTGAAGG + Intergenic
1038612735 8:29070283-29070305 CTCAACTGTGCCTCCTCAGGTGG - Exonic
1041904746 8:63020253-63020275 CTCAAGTGTTCCTATTTTGGAGG + Intronic
1055618164 9:78094748-78094770 CACCACTGTGTGTCTTTTGGAGG + Intergenic
1189170662 X:38906285-38906307 CTCCCCTATGCCTCTTTTGGGGG + Intergenic
1192143914 X:68667812-68667834 CTTGACTGTGCCACTCGTGGTGG + Intronic