ID: 1104411574

View in Genome Browser
Species Human (GRCh38)
Location 12:128562579-128562601
Sequence AGCTGCAGTGCTTCCTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104411574_1104411578 26 Left 1104411574 12:128562579-128562601 CCTTAGAAGGAAGCACTGCAGCT 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1104411578 12:128562628-128562650 TTAATACTTCACCGGCTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 59
1104411574_1104411579 27 Left 1104411574 12:128562579-128562601 CCTTAGAAGGAAGCACTGCAGCT 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1104411579 12:128562629-128562651 TAATACTTCACCGGCTGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1104411574_1104411576 18 Left 1104411574 12:128562579-128562601 CCTTAGAAGGAAGCACTGCAGCT 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1104411576 12:128562620-128562642 AAATCACCTTAATACTTCACCGG 0: 1
1: 0
2: 4
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104411574 Original CRISPR AGCTGCAGTGCTTCCTTCTA AGG (reversed) Intronic
906350887 1:45058132-45058154 AGCTTCAGAGCTTACTTATATGG - Intronic
906916839 1:50021656-50021678 ATCTCCACTGCTACCTTCTAAGG + Intronic
908504790 1:64785923-64785945 TGCTGGATTACTTCCTTCTAGGG + Intronic
909949488 1:81703069-81703091 AGCTGCTTTCATTCCTTCTATGG - Intronic
910084494 1:83383316-83383338 AAATGCAGTCTTTCCTTCTATGG + Intergenic
910105087 1:83623578-83623600 ATCTGCATTGGTTCATTCTATGG - Intergenic
910196290 1:84642880-84642902 TGCTGCAGTGCCTGCTTGTAGGG - Intergenic
910278419 1:85472215-85472237 AGCAGCATTCCTTCCTTCTGGGG - Intronic
910653266 1:89592808-89592830 AGCTGCAGTGTTTACTTTTGGGG + Exonic
911651512 1:100394238-100394260 ACCTGCAGTCCCACCTTCTAGGG - Intronic
912091170 1:106078332-106078354 GACTGCAGTTCTTCCTTCTCTGG - Intergenic
912091299 1:106080032-106080054 GACTGCAGTTCTTCCTTCTCTGG + Intergenic
912917546 1:113831354-113831376 GGGTGCAGAGTTTCCTTCTAGGG - Intronic
914513403 1:148353778-148353800 AGCAGCAGAGCTTCCTTCCCCGG - Intergenic
915792885 1:158694457-158694479 TGCTGCTGTGCTTCCTTTTTTGG - Intergenic
916560651 1:165931752-165931774 GACTGCATTGCTTCCTTCTTGGG + Intergenic
917694204 1:177503575-177503597 ACCTTCAGTGATTCTTTCTATGG - Intergenic
920301169 1:204989978-204990000 AGCATCAGTGCTGCCTTCTCTGG + Intronic
921408998 1:214814532-214814554 AGTTGGATTGGTTCCTTCTAAGG - Intergenic
1063213831 10:3906049-3906071 GGCTGCAGTGATTTCTTCTCTGG + Intergenic
1063258733 10:4358944-4358966 GGCTTCAGTGTTACCTTCTATGG - Intergenic
1063543182 10:6955142-6955164 AGCTGCAGAGCTTGGGTCTATGG - Intergenic
1064061009 10:12137163-12137185 ACCTGCAGTCCTACCTACTAGGG - Intronic
1064678993 10:17790257-17790279 AGCTGAAGTTCTGCTTTCTAAGG + Intronic
1064752299 10:18543222-18543244 AGCTGCAGGGCATCTTTCTTGGG + Intergenic
1066107774 10:32170639-32170661 AGCTGAAGCGCTACCTTTTAAGG + Intergenic
1067200573 10:44168387-44168409 AGATGCTGTGCTTGGTTCTATGG + Intergenic
1070192330 10:74123233-74123255 AGCAGCAGTGCTCCCTGCCAGGG + Exonic
1070573712 10:77661075-77661097 GGGTGCAGAGCTTCCCTCTAGGG - Intergenic
1072446717 10:95505143-95505165 AGTTGGATTGCTTCCTTGTATGG + Intronic
1073332655 10:102680594-102680616 AGGTGCACTGCTTCTTTCCAAGG + Intronic
1074415568 10:113264221-113264243 AGGTGCAAGGCTTCCTTCTCTGG - Intergenic
1075383420 10:122037427-122037449 AGCTGCTCTGCTTCCTCCTTGGG - Intronic
1075788122 10:125063924-125063946 GGCTGCAGTGCCACCTTCCAGGG + Intronic
1076645153 10:131948682-131948704 AGGGGCAGTGGTTCCTGCTATGG - Intronic
1080333728 11:31173015-31173037 AGTTGTATTGATTCCTTCTAAGG - Intronic
1080926219 11:36759294-36759316 GGCTACAGTGCTTGCCTCTAGGG + Intergenic
1082843771 11:57711237-57711259 AGTTGCCATTCTTCCTTCTAAGG - Intronic
1083177549 11:60960783-60960805 TGCTGCATTCCTTCCTTCTGGGG + Intergenic
1084063688 11:66691422-66691444 AGCTGCAGCGCTTCCTGCACGGG - Exonic
1084321878 11:68377767-68377789 AGCTCCAGGGCCTCCTTCTCAGG - Intronic
1088779076 11:113116383-113116405 GGCTGCAGTGCTTTCTCCAAGGG + Intronic
1091177894 11:133578559-133578581 AACCGCAATGCTTGCTTCTAGGG + Intergenic
1091663368 12:2400832-2400854 AGCTGCTGTGCCTCCTTCCGTGG - Intronic
1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG + Intergenic
1092597410 12:10022602-10022624 AGCTGTACTGCTTCCTAATAAGG - Intergenic
1093821682 12:23626617-23626639 AGGTGCAGAGTTTCCTTCTGGGG + Intronic
1097193675 12:57232403-57232425 AGCTGCCCTGCTTCCTTCTCAGG + Intronic
1098212854 12:68184827-68184849 TGCTCCCATGCTTCCTTCTAGGG + Intergenic
1098910322 12:76202621-76202643 AGTTGAAGTGCTTCCTCCTGGGG + Intergenic
1099100955 12:78439734-78439756 AGCTGCACTGCTTCCTGTTGGGG + Intergenic
1100516869 12:95336560-95336582 GGCTGCAGTCTTTCCTTTTAGGG + Intergenic
1101671426 12:106878450-106878472 AACTACAGAGCTTCCTTCTCAGG + Intronic
1102880875 12:116483611-116483633 AGTGTCAGTACTTCCTTCTATGG + Intergenic
1103126821 12:118430593-118430615 ATCTGCAGTTTTGCCTTCTATGG + Intergenic
1103345646 12:120248312-120248334 AGCTGGCGTGCTTCCCTCTGGGG - Intronic
1104411574 12:128562579-128562601 AGCTGCAGTGCTTCCTTCTAAGG - Intronic
1106070132 13:26402768-26402790 CACTGCTCTGCTTCCTTCTAAGG - Intronic
1106114966 13:26809659-26809681 AGCTGCAGTGATTTCTGCTAGGG - Intergenic
1106920500 13:34558229-34558251 AGATGCAATGCTTCATTCCAAGG + Intergenic
1109798161 13:67342999-67343021 AGCTACAGATCTTCCTACTATGG - Intergenic
1111406664 13:87815577-87815599 AGTTTCAGTGATTTCTTCTAAGG - Intergenic
1111999850 13:95199947-95199969 AGGTGTAGTGCTTCCTGCGAAGG - Intronic
1115268730 14:31527865-31527887 AGCTGGATTGGTTTCTTCTAAGG + Intronic
1115665580 14:35541618-35541640 ATCTGCAGTGCTTCCCTAAAGGG - Intronic
1116295427 14:43100789-43100811 AGCTGCAGAGCTGTCTTCTTTGG + Intergenic
1119554491 14:75542722-75542744 AGCAAGAGTGCTTCCTGCTAGGG - Intronic
1119856107 14:77902195-77902217 AGCTGCGGTTCTTCCTCCTGCGG - Intronic
1119861577 14:77939940-77939962 AGCTGCATTTCTTCCTTCTCTGG - Intergenic
1120295684 14:82637307-82637329 AGGAGCACTGCTTCTTTCTATGG + Intergenic
1120409285 14:84131579-84131601 AGCTCCAGTGTTTCCTACTGAGG + Intergenic
1120438497 14:84506711-84506733 AGATGCAGTGGTTACTACTATGG - Intergenic
1122969960 14:105148498-105148520 AGCTCCAGTGCTTCCTCCCCCGG - Intronic
1126378134 15:48017322-48017344 AACTTCAGTGCTTACTTCTCAGG - Intergenic
1127368104 15:58310122-58310144 AGCAGGGTTGCTTCCTTCTAAGG - Intronic
1131003197 15:88954880-88954902 AGCTGCAGTGGTCCCTGCCAAGG - Intergenic
1131575567 15:93587168-93587190 AGTTGAAGTGCTTCCATGTAAGG - Intergenic
1132309026 15:100842811-100842833 AGCTGCAAGGCTTCCTGCTCTGG + Intergenic
1133390821 16:5408556-5408578 AGCGACAGTGCTTCCTGCTTCGG + Intergenic
1134387937 16:13791815-13791837 AGGTGCTGTGCTCCTTTCTATGG + Intergenic
1134593329 16:15475118-15475140 TGCTGCATTGCTTCCTGGTAGGG + Intronic
1135615809 16:23910009-23910031 GGCGGCACTGCTTCCTGCTATGG - Intronic
1136136034 16:28257498-28257520 AGCTCCAGTGTTCCCTTCTTGGG + Intergenic
1138442868 16:57045691-57045713 ATCTGCATTGCCTCCTTCCAAGG - Intronic
1141000386 16:80302115-80302137 AGTTACAGTGCATCCTGCTAGGG - Intergenic
1141133521 16:81450880-81450902 AGCAGCAGTGCTTGCCTCCAAGG - Intronic
1142725689 17:1811970-1811992 AGCTGCAGTGCTGTACTCTAAGG - Exonic
1142878321 17:2865890-2865912 AGCTGCAGTCCCTCCTTAAATGG + Intronic
1143364985 17:6401484-6401506 AATTGCAGTGCTTTCTTTTAGGG - Intronic
1144295505 17:13871425-13871447 AGCTGCAGTCATTCATTCTGTGG - Intergenic
1146645213 17:34572652-34572674 GGCTCCTGTGCTTCCTTCCAGGG + Intergenic
1147563217 17:41521458-41521480 GGCTGCACTGCCTCATTCTAAGG - Exonic
1147732223 17:42610819-42610841 ACCTGTAGTACTTACTTCTAGGG - Intronic
1147755661 17:42765867-42765889 AGCTGGAGTACGTTCTTCTAGGG + Intergenic
1147894498 17:43741675-43741697 AGCTGATGTGCTTGCTTCTTGGG + Intergenic
1148195504 17:45709968-45709990 AGCTGCAGTGCTCCGTGCTCTGG - Intergenic
1151064660 17:71135869-71135891 AGCAGCAGTGCTTCTTTGAAAGG + Intergenic
1151523830 17:74650162-74650184 AGCTGCAGGGAAGCCTTCTAAGG - Intergenic
1153157752 18:2168195-2168217 AGCAGCATTCCTTCCTTCTGGGG - Intergenic
1154203252 18:12314811-12314833 ACCTGCTGTGCTTCCTTTTTTGG - Intronic
1156069163 18:33185122-33185144 AGCTGCAGTGCACCTTTCTGTGG - Intronic
1158936257 18:62367348-62367370 AGTTGCAGTTCATCCTTCTTAGG - Intronic
1159438404 18:68447050-68447072 AGTTGCTGTGCTTCTTTCTTTGG + Intergenic
1160241708 18:77129653-77129675 AGCTCCAGAGCTTCCTTCACGGG + Intronic
1161914636 19:7219334-7219356 AGCTGCAGAGCTCCCCTCCATGG - Intronic
1163204999 19:15795898-15795920 ATCTGCAGTGCTAGCTTCTCTGG - Intergenic
1163225122 19:15955163-15955185 AGATGCAGTCCTTCCTACTAGGG + Intergenic
1164567925 19:29341588-29341610 AGCTGAAGTGCTTGCTTCAAAGG + Intergenic
1166239633 19:41481075-41481097 AGCAGCAGTGCTGCCTTGTGGGG - Intergenic
1167735855 19:51294160-51294182 AGCAGCAGAGCTTCCTTCTGAGG + Intergenic
1168523678 19:57072047-57072069 ACCTGCAGTGCTTCCTTAACAGG + Intergenic
925065452 2:926088-926110 AGCTGCAGTTATTCATTCTCAGG + Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925621109 2:5793782-5793804 AGATGCAGTGCTGACTTCTTGGG - Intergenic
927890826 2:26747676-26747698 ACCTGCAGTGCTAGCTACTAGGG - Intergenic
928621517 2:33092943-33092965 ACCTGCACTCCTTCCTTTTAGGG + Intronic
930102898 2:47616839-47616861 ACCTGCAGTGCTGCTTTTTATGG - Intergenic
930232242 2:48854944-48854966 ACCTGCAGTGCTTCATTCAAAGG - Intergenic
931248186 2:60508373-60508395 GGCTGCAGTGCTTGCTCCTGTGG - Intronic
936978175 2:118239717-118239739 AGCTCCAGTTCTTCCTTCCAGGG + Intergenic
938196454 2:129333382-129333404 AGCGGGATTGCTTCCTTCTAAGG + Intergenic
940071904 2:149698165-149698187 CACTGCACTGCTTCCTTCAAGGG - Intergenic
941172286 2:162154097-162154119 ATCTGCAGATCTTCCTTCTTAGG - Intergenic
945783239 2:214203439-214203461 AGCAGCTCTGCTTCCTTCAAAGG - Intronic
945964433 2:216170882-216170904 TTCTGCAGTTCTTCCTTCCATGG + Intronic
946538730 2:220660381-220660403 ACCTGCTATGCTTCCTTCTGGGG - Intergenic
947990982 2:234487405-234487427 ACCTGCAGTGTCTCCTTCTGAGG + Intergenic
948145536 2:235705437-235705459 AGCTGTCCTGCTTCCTTCCAAGG - Intronic
1169808571 20:9584662-9584684 ATCTGTTCTGCTTCCTTCTATGG + Intronic
1170163270 20:13337363-13337385 AGTAGCAGTGCTTACTTCAAAGG - Intergenic
1170829061 20:19824032-19824054 AGCTGCTCTGCCTGCTTCTATGG + Intergenic
1170886154 20:20341266-20341288 AGTTGAAATGCTTCCTTATATGG - Intronic
1171949526 20:31408325-31408347 AGCTGTAGTCCTACCTACTAGGG + Intronic
1172195402 20:33088375-33088397 AGCTGCATGGCTTACTTCTGTGG + Intronic
1172525646 20:35599480-35599502 CACTGCAGAGCTTCCTTCAAAGG + Intergenic
1173703663 20:45094727-45094749 AGCTGCATTCCTTCCTCCAAAGG - Exonic
1174783949 20:53415357-53415379 AGCTACAGTGCCTGCTTCTCTGG - Intronic
1177726167 21:24971148-24971170 AGTTGGAGAGCTTTCTTCTAGGG + Intergenic
1181761578 22:25062412-25062434 AGGTACAGTGCTTCCTTCTGGGG - Intronic
1182722254 22:32412667-32412689 AGCTGCCATGCTTCATTCTTTGG - Intergenic
1183802327 22:40177180-40177202 AGCTGCAGAGCTACCTCCTGCGG + Intronic
1184616628 22:45642276-45642298 AAATGCAGAGCTCCCTTCTAGGG - Intergenic
949388695 3:3535541-3535563 GGCAGCAGTGGTTCCTTCGAAGG + Intergenic
950965986 3:17146049-17146071 AGTTGCAGTTCCTCCTGCTAGGG - Intergenic
956574850 3:70740933-70740955 GACTGCAGTGTTTCTTTCTAAGG - Intergenic
957008134 3:74973974-74973996 AGCTGCAAACCTTCCTTCTTAGG + Intergenic
957761126 3:84558161-84558183 AGTTACAGTGTTTCCTTCTGGGG + Intergenic
958156772 3:89765140-89765162 GACAGCAGTGCTTTCTTCTATGG - Intergenic
959435323 3:106307744-106307766 AGCTGCAGTGCTTCATTTCTAGG + Intergenic
960247939 3:115420200-115420222 ACCAGCAGTTCTGCCTTCTAGGG + Intergenic
960671205 3:120156762-120156784 AGCAGTGTTGCTTCCTTCTAAGG - Intergenic
960718784 3:120604776-120604798 AGTTGCAGTGCTGACTTCTTAGG - Intergenic
960901032 3:122554778-122554800 GGCTGCAGTGATTCCTGCCAGGG - Intronic
961011583 3:123440030-123440052 AGCTGCGTCGCTTCCTTCTGTGG + Intronic
962151136 3:132894576-132894598 AGCTGGAGTGATTCCTTTGAAGG + Intergenic
962701026 3:137999753-137999775 GGCTGCCGTGCCCCCTTCTAGGG + Intronic
964490040 3:157226560-157226582 ATTTGAAGTGCTTCCTACTATGG + Intergenic
967301814 3:188021643-188021665 AGCAGGGTTGCTTCCTTCTAAGG - Intergenic
967423991 3:189305081-189305103 AGCTGCCATCTTTCCTTCTAGGG + Intronic
971876383 4:32314326-32314348 AGCTTAATTGCTTCCTTCTTTGG + Intergenic
971894068 4:32567454-32567476 AACTTCAGTGTTTCCTTCTTGGG - Intergenic
972589084 4:40467203-40467225 AGCTGGAGTACTTGCTTCAATGG - Intronic
973333342 4:48931733-48931755 AATTGCTATGCTTCCTTCTAAGG - Intergenic
975275168 4:72489284-72489306 ATCTGCAGTGTTGCTTTCTATGG + Intronic
976115911 4:81725940-81725962 TGCTGAAGTGCTTTCTTTTATGG - Intronic
977399820 4:96518823-96518845 AGCAGGATTGGTTCCTTCTAAGG + Intergenic
977565276 4:98574521-98574543 AGCTGCAGTGCTTCATCCAAGGG + Intronic
977574521 4:98661885-98661907 ATCTGCTGTGACTCCTTCTAGGG + Intergenic
981257562 4:142680362-142680384 AGCTGAAGTGCTTCCCTTGAGGG - Intronic
981300163 4:143178161-143178183 AGCTACAGATCTTCCTACTATGG - Intergenic
981600690 4:146485300-146485322 AGCTGCAGTGATTCATTTTGAGG + Intronic
982968692 4:161950481-161950503 CGCTGCAGTGCTTCATACTCTGG + Intronic
983553885 4:169042839-169042861 AGCTGTAGAGCCTCCTTCTGGGG - Intergenic
983915371 4:173286372-173286394 AGCAGGAGTGCTGCCCTCTAAGG - Intronic
984648830 4:182247452-182247474 GGTTAAAGTGCTTCCTTCTAAGG - Intronic
986448143 5:7840942-7840964 AGCCGGATTGGTTCCTTCTAGGG - Intronic
989529483 5:42491061-42491083 AGCTCCAGTGTTTACTTCTTTGG - Intronic
990716595 5:58644330-58644352 AGCTTCAGTTGTTTCTTCTAGGG + Intronic
992699771 5:79330177-79330199 AGCAGGATTGGTTCCTTCTAAGG - Intergenic
995736972 5:115311896-115311918 AGTTACAGTGCTTGCTGCTAGGG + Intergenic
996122037 5:119683574-119683596 AGCTTCACTGCTTCCTTATATGG - Intergenic
999045828 5:148468457-148468479 AGATTCAGTTCTTCCTTCTAAGG - Intronic
1001081222 5:168669082-168669104 AGCTACTGTGCTTCTTTATAGGG - Intronic
1001557808 5:172648117-172648139 GGCTGGAGTCCTTCCTTCTCGGG + Intronic
1001609473 5:172988667-172988689 AGCTGAAGTGCTTCACACTATGG + Intronic
1002284335 5:178152295-178152317 AGCAGAAGTGCTACCTTCTTAGG - Intronic
1003112921 6:3264124-3264146 AGCTGCACTGACTCCTCCTAAGG - Intronic
1003856202 6:10278921-10278943 AGCAGGACTGCTTCCTTCTGAGG + Intergenic
1005309591 6:24546780-24546802 AGCTGCTGTGATTGCCTCTAAGG - Exonic
1006322610 6:33329086-33329108 AGCTGCTGTGGTTACTACTATGG - Intronic
1006683719 6:35815072-35815094 CGCCTCAGTGCCTCCTTCTAGGG - Intronic
1008716390 6:54295039-54295061 AGCTGAAGTGCTTCATTGTGTGG + Intergenic
1008995887 6:57658574-57658596 AGAAGTAGTGTTTCCTTCTAGGG + Intergenic
1009340357 6:62546895-62546917 AGCTGCAGTGCTTCTATAAAGGG - Intergenic
1011036702 6:82984933-82984955 AGCTGCAGTCCTACCTACTTGGG - Intronic
1013547683 6:111175110-111175132 AGCTCCAGTTCTGCCTTCTGAGG + Intronic
1014103249 6:117535147-117535169 AGCTGCAATACTTCCTTCTCTGG - Intronic
1015133942 6:129846863-129846885 ATCTGCAGTGCTTCTTTCTTAGG - Intronic
1016334305 6:142987992-142988014 AGTTGCAGTGATTCTTTCCAGGG + Intergenic
1018572742 6:165227910-165227932 GGCTGCAATGCTTGCTTCTGTGG - Intergenic
1018693676 6:166371941-166371963 ATCTGCAGTTTCTCCTTCTATGG - Intronic
1019151373 6:170008111-170008133 AGCTGCTGCCCTTCCTTCAAGGG - Intergenic
1021706511 7:23373333-23373355 AGCGACAGTGGTTTCTTCTAGGG - Intronic
1022090619 7:27105784-27105806 GGCTCCAGTGCCTGCTTCTAAGG + Intergenic
1022109577 7:27220227-27220249 AGGTGCTGGGCTTCCTCCTATGG - Intergenic
1022640443 7:32177736-32177758 AGCCCCAGTGCTTCCCTGTATGG + Intronic
1023880625 7:44318612-44318634 ACCTGCAGTACTTCATTGTAAGG + Intronic
1026321852 7:69275160-69275182 ATCTCCACTGCTTCCTTCTCTGG + Intergenic
1027301313 7:76839435-76839457 AAATGCAGTCTTTCCTTCTATGG + Intergenic
1034823493 7:154238519-154238541 TGCTGCTGTGCTTCCTTGTTAGG - Intronic
1035546111 8:483557-483579 AGCTGCACTGGCTCCTTCCATGG - Intergenic
1036730961 8:11264443-11264465 AGCAGGATTGGTTCCTTCTAAGG - Intergenic
1036762438 8:11518660-11518682 AGCTGCAGTGATCCCTTTAAAGG + Intronic
1037627747 8:20622803-20622825 AGCTGCAGTGCTTAGTTTCAAGG + Intergenic
1038799987 8:30740908-30740930 GGCTGCAAAGCTTCCTTCTCAGG + Intronic
1039827562 8:41188031-41188053 AGTTGCATTGCATCCTTCTCAGG + Intergenic
1040804253 8:51377237-51377259 TGCTGGAGTTTTTCCTTCTAGGG + Intronic
1041597253 8:59669527-59669549 AGTTGCTGTGCTTCTTTCTCTGG + Intergenic
1043485119 8:80691571-80691593 AGCTTCACTGCTTCCTTCCTCGG + Intronic
1044296619 8:90535292-90535314 TGCTGCAATGCTTGTTTCTATGG - Intergenic
1045587867 8:103559462-103559484 AGCTGCAGAGTTTCCTGCTGTGG + Intronic
1045990615 8:108302481-108302503 AGCTGCAGTGATTTCTGATAGGG - Intronic
1046351907 8:113025972-113025994 AGCTGTAGTGCATCCTATTATGG - Intronic
1048779744 8:137988063-137988085 AGCTGCAGTGCTGGCCCCTAAGG - Intergenic
1048924127 8:139255527-139255549 GACTGCAGTGTTTCATTCTATGG + Intergenic
1049130174 8:140832536-140832558 GACAGCAGTGCTTTCTTCTAAGG - Intronic
1051552676 9:18347625-18347647 AGGAGCAGTGCTTCATTATAGGG - Intergenic
1052036410 9:23686313-23686335 AGATGCAGTGCTTCATTCCTTGG - Intergenic
1056058259 9:82852232-82852254 AGCTACAGAGCTTCATACTATGG - Intergenic
1056953975 9:91067740-91067762 TGCTACAGTGCATCCTTCCAGGG + Intergenic
1057835227 9:98439217-98439239 AGCTACCGTGGTTCCTTCTTGGG + Intronic
1059384667 9:113954881-113954903 AGCTCCAGCCCTTCCCTCTATGG + Intronic
1059589954 9:115648073-115648095 ACCTGCAGTCCTACCTTCTCAGG - Intergenic
1060193896 9:121610572-121610594 AGCTGCAGGGCTACCTCCTAAGG + Intronic
1060814790 9:126629245-126629267 AGCAGCTGGGCTTCCTTCTGCGG - Intronic
1061294507 9:129669644-129669666 AGATGAAGTGCTTGCATCTAAGG + Intronic
1061709320 9:132476826-132476848 AGCAGCAGTGGTTCCTTCTGGGG - Intronic
1061897447 9:133655813-133655835 TGCTGCTGTTCTTCCTCCTATGG + Intronic
1062684378 9:137802760-137802782 AGCTGCAGTGCCTCCTCCGTGGG + Intronic
1186928843 X:14364891-14364913 AGCTGCATTGCTCCCACCTATGG + Intergenic
1187564340 X:20433662-20433684 AGCTGCAGTGTCTCCTGCAAGGG - Intergenic
1188247973 X:27856961-27856983 AGCTGCACTGCATCCTTCTCTGG + Intergenic
1190507168 X:51137587-51137609 AGTTGCTGTGCTTCCTCCTTTGG - Intergenic
1190633977 X:52416812-52416834 TGATGCAGTTCTTCCTTCAATGG + Intergenic
1191615958 X:63169268-63169290 AGCTGCAGAGCTGCCTGCTCAGG + Intergenic
1191620340 X:63209655-63209677 AGCTGCAGAGCTGCCTGCTCAGG - Intergenic
1193151535 X:78129464-78129486 ACCTCCAGTTCTTCCTTTTATGG - Intergenic
1194744290 X:97611444-97611466 ATCTGCAGTCTTTCCTTCTAAGG - Intergenic
1195768235 X:108319428-108319450 TGCTTCAGTGCTTAATTCTAGGG - Intronic
1197097709 X:122614905-122614927 AGCAGGACTGCTTCCCTCTAAGG + Intergenic
1197596716 X:128472577-128472599 AACTGTATTGATTCCTTCTATGG + Intergenic
1197709126 X:129653740-129653762 AGGTGCTGTGCTTCCTCCTTTGG + Intronic