ID: 1104411895

View in Genome Browser
Species Human (GRCh38)
Location 12:128565192-128565214
Sequence GCTGCCAGCCCAATAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104411894_1104411895 0 Left 1104411894 12:128565169-128565191 CCAACAGTCAACAAGGAACTGAA 0: 1
1: 2
2: 22
3: 154
4: 919
Right 1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 153
1104411892_1104411895 29 Left 1104411892 12:128565140-128565162 CCTGGCAGAGAACTGAAGGTGGT 0: 1
1: 0
2: 0
3: 14
4: 209
Right 1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG 0: 1
1: 0
2: 2
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104411895 Original CRISPR GCTGCCAGCCCAATAGCCCA TGG Intronic
900478675 1:2887919-2887941 TCAGCCAGCCCTACAGCCCAAGG - Intergenic
900622445 1:3593548-3593570 GCTGCCAGCCCGAGTCCCCAGGG - Intronic
903772928 1:25775395-25775417 GCAGCCAGCCCACCAGCCCTGGG + Intronic
904340148 1:29829136-29829158 CCTGGCAGCCCAAAGGCCCAGGG - Intergenic
915896049 1:159811762-159811784 GCTGCCTCCCCAATAGCTCTGGG - Intronic
916143215 1:161717756-161717778 GTACCCAGCCCAGTAGCCCAAGG + Intergenic
919685173 1:200477735-200477757 GGAGCCACCCCAATAGCTCACGG - Intergenic
920294133 1:204945607-204945629 GCTGCCCTCCCAATACCCCCAGG + Intronic
1064094982 10:12417563-12417585 GTTCCCAGGCCAACAGCCCAGGG - Intronic
1065084915 10:22164590-22164612 CCTGCAAGCCCAACATCCCATGG + Intergenic
1068793660 10:61054063-61054085 GTTCCCAGCCCAGAAGCCCATGG - Intergenic
1069093478 10:64229826-64229848 GCTGCCAGCACAACAGTCTAAGG - Intergenic
1074763591 10:116685035-116685057 GTTGCCAGCCCGATGGACCACGG + Intronic
1077341814 11:2029593-2029615 GCTGGTAGCCCACTAGCTCAGGG - Intergenic
1079356861 11:19737047-19737069 GCTGCTAGCCGTAGAGCCCAAGG + Intronic
1081702271 11:45159294-45159316 GCTGCCAGGCCAGGAGCCCAGGG - Intronic
1083372514 11:62193206-62193228 CTTGCCAGGCCAATAGCCCTGGG - Intronic
1083378400 11:62244453-62244475 CTTGCCAGGCCAATAGCCCTGGG - Intronic
1084168206 11:67387005-67387027 CCTTCCAGCCCCACAGCCCAGGG + Intronic
1084264589 11:67998249-67998271 GCTGGCAGCCCAGTGCCCCACGG - Intronic
1088249432 11:107850019-107850041 GGTTACAGCCCATTAGCCCAAGG - Intronic
1088360414 11:108983193-108983215 GCTGCCTACCCAGTGGCCCAAGG - Intergenic
1088507692 11:110542245-110542267 GCTACCAGCTCAAATGCCCATGG - Intergenic
1088887667 11:114020581-114020603 CCTGCCAGCCCGAAACCCCAAGG - Intergenic
1090105699 11:123851975-123851997 CCTGCCAGCTCAAGTGCCCATGG + Intergenic
1090404591 11:126469196-126469218 GCTGCCAGCTCCTGAGCCCACGG + Intronic
1091305523 11:134533443-134533465 GGTGCCAGCCCCAGGGCCCATGG + Intergenic
1202824800 11_KI270721v1_random:84782-84804 GCTGGTAGCCCACTAGCTCAGGG - Intergenic
1094007853 12:25774485-25774507 GCTGCCAGCCGAAAATCTCATGG - Intergenic
1094169829 12:27480044-27480066 GCTGCAGGCCCAAGAGCCCCTGG + Intronic
1096742574 12:53704731-53704753 ACTGCCAGTCCCATAACCCAGGG - Intergenic
1098498714 12:71166276-71166298 GCAGCCAGCGCAGGAGCCCACGG + Intronic
1099512736 12:83556922-83556944 GCTTCCATCCCAGTTGCCCAAGG - Intergenic
1100904888 12:99286358-99286380 CCTGCCAGCTAAATAGCCCTTGG + Intronic
1101430484 12:104622855-104622877 GCAGCCAGAGCAATAGCCAAGGG + Intronic
1103955304 12:124573079-124573101 GCTGCCACCTCAAGAGCCCTGGG + Intergenic
1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG + Intronic
1108753487 13:53473054-53473076 GCCGTCACCCCAATAACCCAGGG + Intergenic
1114577593 14:23728240-23728262 GGTGCCAGCTCTATAGCCAAGGG - Intergenic
1116241728 14:42352182-42352204 GCTGCAGGCCCAAGAGCCCCTGG - Intergenic
1118932355 14:70254813-70254835 CCGGCCAGCCCACAAGCCCAGGG + Intergenic
1122140591 14:99660701-99660723 GCTGTCAGGCCCAGAGCCCATGG - Intronic
1126740898 15:51775097-51775119 GCTGCCAGCTCATCTGCCCATGG - Intronic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1132373695 15:101314603-101314625 GAAGCCAGCCCCAGAGCCCAGGG - Intronic
1132723182 16:1327062-1327084 GCTCCCACCCCCAAAGCCCAGGG - Intergenic
1132839876 16:1973781-1973803 GGAGTCAGCCCAACAGCCCAGGG - Intronic
1132886975 16:2186648-2186670 GCTTCCAGCCCCCAAGCCCAGGG + Intronic
1134796408 16:17041035-17041057 GCTGCCATCCCAGCAGCCTAGGG + Intergenic
1136487937 16:30585322-30585344 GCTTCCAGCCCACTAGCCTCTGG + Intronic
1139366368 16:66436031-66436053 GCTGGCAGCCCTAAAGCCAATGG - Intronic
1139480071 16:67225936-67225958 GCAGCCAGCCCAAGAGCAAAGGG + Intronic
1139557951 16:67724567-67724589 GCTGGCAGACCCATAGACCATGG - Exonic
1139953886 16:70684467-70684489 GCTGCCAGGACAACAGCCCCAGG - Intronic
1140450919 16:75070192-75070214 GCAGCCAGCCCACTGGCCCCAGG + Intronic
1144060645 17:11580951-11580973 GGAGCCAGCCCAAGAGCACATGG + Intergenic
1144270412 17:13610048-13610070 CCTGCCAGTCCAGCAGCCCAGGG - Intergenic
1144712988 17:17414574-17414596 GCTGCCAACCCCACAGCCCCAGG - Intergenic
1144935067 17:18891173-18891195 ACTGCCAGCCCACGAGCCCAGGG - Intronic
1146704993 17:34994787-34994809 AATGACAGCCCAATAGCCCCTGG - Intronic
1148471293 17:47895499-47895521 GCGGCGACCCCCATAGCCCACGG - Intergenic
1149399895 17:56285341-56285363 GCTACCAGCACCCTAGCCCAAGG + Intronic
1149991256 17:61384826-61384848 GCTGCCAGGCCCACAGACCAGGG - Intronic
1150319799 17:64203178-64203200 AGTGCCAGCCCTATAGCCCGAGG + Intronic
1151194743 17:72423551-72423573 GCTCCCAGACCAATGGCCCAGGG - Intergenic
1151504237 17:74516036-74516058 GCTGAAAGCCCAAGAGCCCCTGG + Intergenic
1151844703 17:76644306-76644328 GCTGCCAGCCCAAGAGCACATGG + Intergenic
1152433784 17:80263191-80263213 ACTGCCAGCCCAGTAGCCCTGGG + Intronic
1152472653 17:80499022-80499044 GCTGCCAGACATATAGCCCTCGG + Intergenic
1161456646 19:4373015-4373037 GCTCCCAGACCAGGAGCCCAGGG - Intronic
1165076312 19:33281658-33281680 GCTGCCTCCCCAGTAGCCCAGGG - Intergenic
1166271200 19:41715279-41715301 GCTGCCAGCCCAAATCCACAGGG + Intronic
1166419643 19:42626400-42626422 GCTGCCAGCCCAAATCCACATGG - Intronic
1167472368 19:49682376-49682398 GCCGGCAGCCCAAAAGACCATGG - Intronic
1168316975 19:55488775-55488797 TCTGCCAGCCCAGAAGCCCAAGG + Intronic
1168452069 19:56474384-56474406 CCTGCCAGCCCCAGAGGCCAGGG + Intronic
928184871 2:29101360-29101382 GCTGAAGGCCCAATAGCCCCTGG + Intronic
929842985 2:45490268-45490290 TCTTCCTGCCCAATAGTCCAAGG - Intronic
932292407 2:70593744-70593766 GCTGCCAGTCCCACAGCCCCAGG + Intergenic
934519474 2:95010811-95010833 ACTGCCAGGCCTAGAGCCCAGGG - Intergenic
934528826 2:95072375-95072397 GCTGCCAGAACAATGGCCCCAGG - Intergenic
934917409 2:98311527-98311549 ACTCCCAGCCCAAAAGCCCCTGG - Intronic
935705124 2:105849951-105849973 GCTGCCTCTTCAATAGCCCAGGG - Intronic
937448761 2:121982533-121982555 GCTCCCAGCCCTATAGCCATAGG + Intergenic
937766307 2:125664740-125664762 GGTGCCAGACCAAGAACCCACGG - Intergenic
939986077 2:148831049-148831071 GCTGCCAGCAAAAGAGGCCATGG - Intergenic
946175828 2:217921477-217921499 GCTGTCATCCCAGCAGCCCAGGG + Intronic
947676518 2:231986115-231986137 GCTGAAAGCCCAAGAGCCCCGGG - Intronic
948778592 2:240303153-240303175 GGTGCCAGCCCACTTGCCTAAGG + Intergenic
1171085724 20:22236511-22236533 GCTGACAGCCCACGAGCCCAGGG + Intergenic
1171099086 20:22365491-22365513 GACGCCAGTGCAATAGCCCATGG - Intergenic
1171481876 20:25460640-25460662 GCTGCAAGGCCAAGAGCCTATGG + Intronic
1174080394 20:47967253-47967275 TCTCCCAGCACAGTAGCCCATGG - Intergenic
1175978173 20:62723976-62723998 GCTGCCAGACCTCTTGCCCATGG - Intronic
1178496353 21:33089694-33089716 GCTGAAAGCCCAAGAGCCCCTGG + Intergenic
1179579172 21:42329278-42329300 GTTGCCTGGCCAATACCCCAGGG + Intergenic
1180798477 22:18619657-18619679 GAAGCCAGCCCAGTAGGCCAGGG - Intergenic
1181223241 22:21375608-21375630 GAAGCCAGCCCAGTAGGCCAGGG + Intergenic
1181255498 22:21560018-21560040 GAAGCCAGCCCAGTAGGCCAGGG - Intronic
1185222796 22:49637354-49637376 GCTGCCAGCACAGGAGCACACGG + Intronic
950017930 3:9767468-9767490 GCTGCTCTCCCAATAGCCCTGGG - Intronic
950118850 3:10468430-10468452 GCCGCCAGCCCTCTGGCCCAGGG - Intronic
950974931 3:17230430-17230452 TCTGCCAGCCCATTTCCCCAAGG - Intronic
953658468 3:44872648-44872670 TCTTCCAGACCAAAAGCCCAGGG - Intronic
960160964 3:114350397-114350419 GCTGCCAGCGCCACAGCCCCTGG - Exonic
960284560 3:115812537-115812559 CCTACCAGCCCAAAAGCCCTGGG - Intronic
960458022 3:117897802-117897824 CCTGCTAGCACAACAGCCCATGG + Intergenic
962107102 3:132401670-132401692 GCTGCCACCCCAAAACCCAAAGG - Intergenic
962203785 3:133418954-133418976 GCTGCCAGAACAAAGGCCCATGG + Intronic
964163334 3:153671850-153671872 GCTGCCACCCCCACAGCCCTTGG - Intergenic
966736316 3:183189801-183189823 GCTGCCAGCCCAGGAGGTCAAGG + Intronic
966919568 3:184602896-184602918 GCTGCCAGGCAAATACCCCCAGG + Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
970171548 4:13295651-13295673 GCTGAAAGCCCTGTAGCCCAGGG - Intergenic
976324267 4:83752772-83752794 GCAGAAAGCCCAAAAGCCCAGGG - Intergenic
980568422 4:134577207-134577229 GCTAAGGGCCCAATAGCCCAGGG - Intergenic
982164813 4:152604872-152604894 CCTGCCAGGCAAACAGCCCATGG + Intergenic
985574452 5:667230-667252 GCGGCCAGCCCCGCAGCCCAGGG + Intronic
985721772 5:1493290-1493312 GCTGCAGGCCCAATCCCCCATGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990501622 5:56402117-56402139 GCTGGCAGCCGTACAGCCCAAGG - Intergenic
991028147 5:62052652-62052674 TCTGCCAGCTCAAGAGTCCATGG + Intergenic
997475999 5:134142890-134142912 CCTGCCAGCCCACCTGCCCATGG - Intronic
1002191095 5:177478076-177478098 GTGGCCAGCCCTTTAGCCCAGGG + Intergenic
1004503587 6:16229787-16229809 GCTCCCAGACCAAGACCCCAGGG - Intergenic
1006093536 6:31642191-31642213 GCTGCCAGCCCGAGCCCCCAGGG + Exonic
1013981649 6:116137160-116137182 GCTGCCACCCCAAAACCCAAAGG + Intronic
1014352676 6:120363643-120363665 GCTGCCAGCACAACAGCCTGAGG - Intergenic
1015151862 6:130049013-130049035 GCTGCCAGCTCTATAGGACAGGG + Intronic
1015726385 6:136303626-136303648 GCTGAAAGCCCAAGAGCCCCTGG - Intergenic
1015914834 6:138205270-138205292 TCTTACAGCCTAATAGCCCAGGG - Intronic
1016331699 6:142959383-142959405 TCTACCAGACCAATAACCCAAGG - Intergenic
1016331980 6:142962704-142962726 TCTGCCAGACCAATAACCCAAGG + Intergenic
1018234606 6:161711879-161711901 GCTGAAGGCCCAATAGCCCCTGG - Intronic
1019336037 7:483297-483319 CCCGCCCGCCCAATATCCCACGG - Intergenic
1022567836 7:31421158-31421180 GCTGCCCTCCCAATAACCCTGGG + Intergenic
1023876184 7:44287417-44287439 GCTGCCAGCCCAAGTTCCCCGGG - Intronic
1023997910 7:45173409-45173431 GCAGCCTGGACAATAGCCCAGGG - Intronic
1028640786 7:93039862-93039884 GCTGCCAGTCCCACAGACCAGGG + Intergenic
1029115677 7:98235914-98235936 GCTGTCAGCCCAGAGGCCCAGGG - Intronic
1036558004 8:9876851-9876873 ACTGCCAGCACAATAGTCTAAGG + Intergenic
1038351082 8:26776956-26776978 GCTGCCACACCAACAGGCCAAGG + Intronic
1038438900 8:27558223-27558245 ACTGCCAGCTCCATGGCCCAGGG - Intergenic
1041558123 8:59182751-59182773 CCTCCCAGCCCACTAGCCCCTGG - Intergenic
1046420713 8:113980122-113980144 CCTGCCAGCTCAAACGCCCATGG - Intergenic
1047502982 8:125456436-125456458 GCTGCTAGCCCGATAGTCCTTGG + Intergenic
1048361942 8:133705017-133705039 GTTGCCAGGTCAAGAGCCCATGG - Intergenic
1055960596 9:81817028-81817050 TTTGCCAGGCCAATAGTCCAGGG + Intergenic
1056844101 9:90022626-90022648 GCTGCCAGCACAAAATACCATGG - Intergenic
1056964148 9:91152129-91152151 TCTGTCACCCCAATGGCCCAGGG + Intergenic
1058533185 9:105927309-105927331 GCTGCTAGACCAATAGAACATGG + Intergenic
1059975611 9:119713614-119713636 GGAGCCAGCTCAATATCCCATGG + Intergenic
1061179113 9:129013657-129013679 GCTGCCAGCTGATTAGCCGAGGG - Intronic
1061729885 9:132605625-132605647 GCTGCCACCACAACAGACCAGGG + Intronic
1061973934 9:134058953-134058975 GCTGCCAGCACACCGGCCCAAGG - Intronic
1188970823 X:36613295-36613317 GCAGCCAGCCCAAGCGTCCATGG - Intergenic
1189091900 X:38092415-38092437 GCTGAAAGCCCAAGAGCCCCTGG + Intronic
1189897683 X:45672963-45672985 GCTGCCAGCTCAAGTGTCCATGG - Intergenic
1191207984 X:57854086-57854108 TCTGCCAGCTCAATTGTCCATGG + Intergenic
1191858275 X:65645069-65645091 CCTCCCAGCCCAGTAGCCCAGGG - Intronic
1192179597 X:68908238-68908260 GCTGGCAGAGCCATAGCCCAGGG + Intergenic
1192585215 X:72313746-72313768 GCTGACACCCGAACAGCCCAGGG - Intergenic
1200402147 X:156025900-156025922 GCTGAGAGCCCAATGGCCCTTGG + Intergenic
1200618911 Y:5415799-5415821 GCTGCTAGCTCAAGTGCCCATGG + Intronic
1200742408 Y:6868324-6868346 GGTGCCAGCTCAGCAGCCCAGGG - Exonic