ID: 1104416665

View in Genome Browser
Species Human (GRCh38)
Location 12:128601461-128601483
Sequence CAGAGAAAGGAGGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3070
Summary {0: 1, 1: 2, 2: 35, 3: 369, 4: 2663}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104416660_1104416665 0 Left 1104416660 12:128601438-128601460 CCTTGCTGCCATGGGACTCATGA 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG 0: 1
1: 2
2: 35
3: 369
4: 2663
1104416661_1104416665 -8 Left 1104416661 12:128601446-128601468 CCATGGGACTCATGACAGAGAAA 0: 1
1: 0
2: 2
3: 11
4: 196
Right 1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG 0: 1
1: 2
2: 35
3: 369
4: 2663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104416665 Original CRISPR CAGAGAAAGGAGGAGGAAGA TGG Intronic
Too many off-targets to display for this crispr