ID: 1104416964

View in Genome Browser
Species Human (GRCh38)
Location 12:128603512-128603534
Sequence CAGACTAAACACAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104416964_1104416970 -5 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416970 12:128603530-128603552 GTCTGGCCAGGAGTGGATGCTGG 0: 1
1: 0
2: 1
3: 23
4: 289
1104416964_1104416972 -1 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416972 12:128603534-128603556 GGCCAGGAGTGGATGCTGGGCGG 0: 1
1: 0
2: 4
3: 51
4: 615
1104416964_1104416975 3 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416975 12:128603538-128603560 AGGAGTGGATGCTGGGCGGAGGG 0: 1
1: 0
2: 5
3: 205
4: 984
1104416964_1104416971 -4 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416971 12:128603531-128603553 TCTGGCCAGGAGTGGATGCTGGG 0: 1
1: 0
2: 3
3: 21
4: 245
1104416964_1104416974 2 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416974 12:128603537-128603559 CAGGAGTGGATGCTGGGCGGAGG 0: 1
1: 1
2: 2
3: 30
4: 556
1104416964_1104416976 8 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416976 12:128603543-128603565 TGGATGCTGGGCGGAGGGCTTGG 0: 1
1: 0
2: 1
3: 40
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104416964 Original CRISPR CAGACTAAACACAGGCATGG AGG (reversed) Intronic