ID: 1104416964

View in Genome Browser
Species Human (GRCh38)
Location 12:128603512-128603534
Sequence CAGACTAAACACAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104416964_1104416974 2 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416974 12:128603537-128603559 CAGGAGTGGATGCTGGGCGGAGG 0: 1
1: 1
2: 2
3: 30
4: 556
1104416964_1104416976 8 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416976 12:128603543-128603565 TGGATGCTGGGCGGAGGGCTTGG 0: 1
1: 0
2: 1
3: 40
4: 504
1104416964_1104416971 -4 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416971 12:128603531-128603553 TCTGGCCAGGAGTGGATGCTGGG 0: 1
1: 0
2: 3
3: 21
4: 245
1104416964_1104416975 3 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416975 12:128603538-128603560 AGGAGTGGATGCTGGGCGGAGGG 0: 1
1: 0
2: 5
3: 205
4: 984
1104416964_1104416972 -1 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416972 12:128603534-128603556 GGCCAGGAGTGGATGCTGGGCGG 0: 1
1: 0
2: 4
3: 51
4: 615
1104416964_1104416970 -5 Left 1104416964 12:128603512-128603534 CCTCCATGCCTGTGTTTAGTCTG 0: 1
1: 0
2: 4
3: 21
4: 214
Right 1104416970 12:128603530-128603552 GTCTGGCCAGGAGTGGATGCTGG 0: 1
1: 0
2: 1
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104416964 Original CRISPR CAGACTAAACACAGGCATGG AGG (reversed) Intronic
901753859 1:11429052-11429074 GAGACAAAACACAGGCAAGAAGG + Intergenic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
903205388 1:21778477-21778499 AATATTAAACACAGACATGGTGG + Intronic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
905097865 1:35489951-35489973 CAAACAAAAGCCAGGCATGGTGG - Intronic
905686167 1:39910192-39910214 CAGAGTAGAGCCAGGCATGGTGG + Intergenic
905705230 1:40051407-40051429 CACACAAAAGCCAGGCATGGTGG + Intronic
906630543 1:47363655-47363677 CAAACAAAAAACAGGCACGGTGG + Intronic
907702484 1:56802536-56802558 CAGCATAGACACAGGCATGGAGG + Intronic
907818949 1:57948011-57948033 TAGCATAAGCACAGGCATGGAGG - Intronic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912861775 1:113219841-113219863 CAGAGTGACCACAGGCCTGGTGG + Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
917183436 1:172323966-172323988 CAGGCAACACACAGGAATGGTGG + Intronic
919864335 1:201768348-201768370 AAGAGTAAGTACAGGCATGGTGG + Intronic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
1063221044 10:3968208-3968230 CATGTTAAACACAGACATGGAGG + Intergenic
1063300555 10:4845760-4845782 CAGACCTAACAGAGGAATGGGGG - Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1066374740 10:34847502-34847524 CAAACTACAAAAAGGCATGGTGG + Intergenic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1075109511 10:119566755-119566777 CAAAAAAAACCCAGGCATGGTGG - Intergenic
1078124868 11:8551415-8551437 CAGAATAAGGCCAGGCATGGTGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1083962433 11:66021727-66021749 CAGACTAAACACACGCAGCCTGG + Intronic
1084337097 11:68465167-68465189 AAAACAAAAAACAGGCATGGTGG - Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1085154172 11:74278252-74278274 CAGCATAAGCACAGACATGGAGG + Intronic
1085370242 11:75996601-75996623 CAGTTTATACAGAGGCATGGAGG + Intronic
1085779295 11:79393912-79393934 CAGAGTAAGAACAGGCCTGGAGG + Intronic
1088670706 11:112137737-112137759 CAGACTCAGGCCAGGCATGGTGG - Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1090709857 11:129374925-129374947 AAAATTAAAAACAGGCATGGTGG - Intergenic
1091049235 11:132352614-132352636 CACACTGGACACAGGCCTGGGGG - Intergenic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1093683449 12:22029983-22030005 CAGATTAAAGCCAGGCATGGTGG + Intergenic
1093757114 12:22865049-22865071 GAGACAAAAGAAAGGCATGGAGG - Intergenic
1096262264 12:50100222-50100244 CAGACTCAACACAGCAAGGGTGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104522273 12:129486706-129486728 GAGAAGAACCACAGGCATGGAGG - Intronic
1105051027 12:133051072-133051094 CAAACAAAACACAGGCATGGTGG - Intronic
1105495954 13:20931153-20931175 CAAACTAAGGCCAGGCATGGTGG - Intergenic
1106416325 13:29549047-29549069 AAGACTGAAGACAGGCAAGGTGG - Intronic
1106931538 13:34670966-34670988 CAGCCTCAGCCCAGGCATGGAGG + Intergenic
1107697218 13:43012001-43012023 CAACCTAAAGCCAGGCATGGTGG - Intergenic
1110559000 13:76889831-76889853 GAGACTAAACACAGGGCTAGTGG - Intergenic
1110696864 13:78501292-78501314 CAGAATAAACCCAGGTATGAAGG + Intergenic
1111164197 13:84436782-84436804 CAGACTAAACGCAGTTATCGTGG - Intergenic
1115267939 14:31520895-31520917 GAGATGAAACACAGGGATGGGGG + Intronic
1117257011 14:53988082-53988104 GAAACTAAAGCCAGGCATGGTGG - Intergenic
1118248945 14:64139562-64139584 CAGAAAATACCCAGGCATGGTGG - Intronic
1119643383 14:76330694-76330716 GAAACAAAACACAGGTATGGAGG + Intronic
1121189030 14:92007574-92007596 TAAACTAAACACAGAAATGGTGG - Intronic
1121277667 14:92678903-92678925 CAGAAGAACCACAGGCACGGTGG + Intronic
1122034919 14:98940974-98940996 CACACTAAACAGAGCCAAGGTGG - Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1202884365 14_KI270722v1_random:90334-90356 CAGACGAAGGCCAGGCATGGTGG - Intergenic
1124688384 15:31801173-31801195 CACACTCAACACAGGCAGGATGG + Intronic
1125401787 15:39311899-39311921 CAGACTGCACACATGCATGAGGG - Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1127321878 15:57855028-57855050 CATGCTAAACACAGACATTGAGG - Intergenic
1128199911 15:65795752-65795774 CAAACAAAAAACAGACATGGTGG + Intronic
1130399370 15:83534971-83534993 CTGATTAAACCCAGGAATGGAGG + Intronic
1130540648 15:84818609-84818631 CAGCATAAAAACAGGCATCGAGG + Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1134466517 16:14483651-14483673 CTGTCTAAAAACAGGCATGAGGG - Intronic
1136053037 16:27666737-27666759 CAGAGTTAGGACAGGCATGGTGG + Intronic
1137441662 16:48503643-48503665 CACACAAAACACAGGCATACAGG - Intergenic
1138493448 16:57392003-57392025 CAAACAAAAAACAAGCATGGTGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1139659107 16:68408861-68408883 CAAACTAAAAACAGGAAAGGTGG + Intronic
1140025591 16:71287719-71287741 CAAACAAAAAACAGGCATAGTGG - Intronic
1143311007 17:5989186-5989208 AAGATTAAACAAAGGCTTGGAGG + Intronic
1143320602 17:6066334-6066356 CTGACTAGTCATAGGCATGGGGG - Intronic
1144171121 17:12660941-12660963 CACACAAAAGTCAGGCATGGTGG - Intergenic
1145811490 17:27766862-27766884 CATACTGAAACCAGGCATGGTGG + Intronic
1146579152 17:34021497-34021519 AAGACTAAACTCAGGCCTGGGGG - Intronic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1154192058 18:12238090-12238112 GAGACAAAATACAAGCATGGTGG + Intergenic
1157091639 18:44643630-44643652 CAGAATAGTCACAGTCATGGAGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159322243 18:66866922-66866944 TAGAGTAAGCTCAGGCATGGCGG - Intergenic
1160230510 18:77045090-77045112 CAGATTAAACCCAGACATGTAGG - Intronic
1161451856 19:4350694-4350716 CACACTCAACACAGCCATGCTGG - Intronic
1161640387 19:5419026-5419048 CACACTCAACACAGCCATGTCGG - Intergenic
1162457584 19:10795338-10795360 CAAACCAAGCACATGCATGGAGG - Intronic
1163428892 19:17254942-17254964 CAGAATATACAAAGGCTTGGAGG + Intronic
1164890276 19:31817530-31817552 CTGACAAAGCCCAGGCATGGTGG + Intergenic
1168334281 19:55588269-55588291 CAAACAAAAAACCGGCATGGTGG - Intergenic
1202633522 1_KI270706v1_random:21811-21833 CAGACGAAGGCCAGGCATGGTGG - Intergenic
1202652359 1_KI270707v1_random:18258-18280 CAGACGAAGGCCAGGCATGGTGG + Intergenic
1202659775 1_KI270708v1_random:57463-57485 CAGACGAAGGCCAGGCATGGTGG - Intergenic
930009000 2:46920616-46920638 AAGACTAAGGCCAGGCATGGTGG - Intronic
930021088 2:47002713-47002735 CAGAGAAAAGGCAGGCATGGGGG - Intronic
931519315 2:63078220-63078242 CACATAAAACCCAGGCATGGTGG - Intergenic
933668004 2:84980301-84980323 CAGAGGAAAGACAGGCAAGGTGG + Intronic
934686710 2:96326651-96326673 CAGGCTTATCACAGCCATGGAGG - Exonic
935887690 2:107641010-107641032 AATACAAAACCCAGGCATGGTGG - Intergenic
936815259 2:116452760-116452782 CAGACCAAAAACAAGCAGGGAGG - Intergenic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
937816407 2:126255890-126255912 CAGACACAAGCCAGGCATGGTGG + Intergenic
938438048 2:131299375-131299397 GAGACTAAAGACGGGCGTGGAGG + Intronic
938860288 2:135360917-135360939 CAAACCAAAAACAGGCATGGTGG - Intronic
940476719 2:154171154-154171176 CAGACCAAACAAATACATGGAGG + Intronic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
942085655 2:172441401-172441423 AAATCTAAACTCAGGCATGGTGG + Intronic
944429682 2:199619711-199619733 CAGACTATAGACAGGCATACTGG - Intergenic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
946953597 2:224904751-224904773 CATACTAAACAAAGGCATTTTGG + Intronic
948272242 2:236683517-236683539 CAGAGGAATCACAGGCTTGGGGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1171062891 20:21983471-21983493 CAGACTTAAGAGAGGCATGGAGG - Intergenic
1172095172 20:32456965-32456987 CAGCCTAGGCACAGGCACGGTGG + Intronic
1172467468 20:35166772-35166794 CATTCTAAACCCAGGGATGGGGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG + Intronic
1175357890 20:58383355-58383377 CAGCCTAAAATCAGTCATGGTGG + Intergenic
1176599788 21:8781395-8781417 CAGACTAAGGCCAGGCATGGTGG - Intergenic
1176645736 21:9347673-9347695 CAGACGAAGGCCAGGCATGGTGG - Intergenic
1180327248 22:11441025-11441047 CAGACGAAGGCCAGGCATGGTGG - Intergenic
1180367191 22:11951479-11951501 CAGACGAAGGCCAGGCATGGTGG + Intergenic
1180418640 22:12793460-12793482 CAGACGAAGACCAGGCATGGTGG + Intergenic
1180648317 22:17358155-17358177 CACACTACACGCAGCCATGGAGG - Intergenic
1180925797 22:19553957-19553979 CAAACAGAAAACAGGCATGGTGG - Intergenic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
952347441 3:32502232-32502254 CAGTCTAAATACAGGCACTGTGG + Intronic
953007309 3:38990313-38990335 GAGACCGAACACAGACATGGAGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953946489 3:47153030-47153052 AACACAAAAAACAGGCATGGTGG + Intronic
954622277 3:52003000-52003022 CAGACTAAAGAGAGACTTGGCGG + Intergenic
954856761 3:53650498-53650520 CAGACTCATCACACGCATTGGGG + Intronic
955290142 3:57684470-57684492 GAGTCTAAAGCCAGGCATGGTGG + Intronic
956456627 3:69427607-69427629 CTTACTAAACACAGTCATGGAGG - Intronic
957094471 3:75765819-75765841 CAGACGAAGGCCAGGCATGGTGG + Intronic
958867470 3:99517811-99517833 AAGACTAAGCCAAGGCATGGTGG - Intergenic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
961099190 3:124184108-124184130 CAAACCGAACACAGGCATGGAGG + Intronic
961509526 3:127392362-127392384 CAGATTAAACCCAGCCACGGTGG - Intergenic
964012718 3:151910325-151910347 CAGCCTACAAACAGCCATGGAGG - Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
965530595 3:169766737-169766759 CAGTCTAAACTTAGGCGTGGTGG + Intergenic
965619620 3:170629726-170629748 GAGACTAATCACGGGTATGGGGG + Intronic
965988954 3:174792066-174792088 CAAACAAAAAACAGGCATGGTGG + Intronic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967363834 3:188663304-188663326 CAGACTCAAGAAAGGGATGGGGG + Intronic
1202741151 3_GL000221v1_random:57393-57415 CAGACGAAGGCCAGGCATGGTGG + Intergenic
968863782 4:3194595-3194617 CAGACTATACCCAGTCAGGGTGG + Intronic
969539915 4:7781819-7781841 CAGACCCAACACAAGCATGCAGG + Intronic
973191933 4:47395240-47395262 CAGGCTATACAAAGGCTTGGAGG + Intronic
973363147 4:49183817-49183839 CAGACGAAGACCAGGCATGGTGG - Intergenic
973397946 4:49613043-49613065 CAGACGAAGACCAGGCATGGTGG + Intergenic
975460109 4:74641972-74641994 CATAATAAACACACACATGGAGG + Intergenic
978636269 4:110810906-110810928 GAGCCTGAACACAGACATGGTGG - Intergenic
978655253 4:111058512-111058534 TAGAATAAAGCCAGGCATGGTGG - Intergenic
987727163 5:21717225-21717247 CACTCTAATCACAGGCGTGGAGG - Intergenic
988217840 5:28299997-28300019 TTGACAAAACACAGGCAAGGTGG - Intergenic
991460625 5:66854749-66854771 CAGACTAAAAAAAGGTATGAAGG + Intronic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
992683556 5:79177377-79177399 TAGACTAAAGCCAGGCCTGGTGG - Intronic
996149607 5:120019452-120019474 TAGAATAATCACAGGCAGGGAGG - Intergenic
997461147 5:134053370-134053392 CAGAGTATCCCCAGGCATGGTGG - Intergenic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
1001801855 5:174551438-174551460 CAGACTCAACACAGGCCCGAAGG + Intergenic
1001891672 5:175344525-175344547 GAGACTAAGCTCAGGCATGTCGG - Intergenic
1003247021 6:4391079-4391101 GAGGCTAACCACAGGCGTGGTGG - Intergenic
1003273645 6:4629363-4629385 AAAACTATACACAAGCATGGAGG + Intergenic
1003439717 6:6128304-6128326 TAGACTATACACAGGCATTTTGG - Intergenic
1005218397 6:23558258-23558280 CAGTGTAAACACTGCCATGGTGG + Intergenic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1006138619 6:31913229-31913251 CAGACTACAGTCAGGCATGGTGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1007867797 6:44992653-44992675 CAGACTAAAGAAAGGAATAGGGG + Intronic
1009680477 6:66885273-66885295 CTGACTTAAGCCAGGCATGGTGG - Intergenic
1009850810 6:69195743-69195765 CAGACTGAACAAAGTCCTGGTGG + Intronic
1011497560 6:87951555-87951577 TAGCCCAATCACAGGCATGGGGG - Intergenic
1012646958 6:101696980-101697002 CAGACTAAACTCATACATAGAGG + Intronic
1013134492 6:107267736-107267758 AAAACAAAAAACAGGCATGGTGG - Intronic
1014233267 6:118928122-118928144 CAGACTCAGGCCAGGCATGGTGG + Intronic
1017955737 6:159176354-159176376 CAGAGGACACACAGGCAAGGAGG + Intronic
1019271236 7:150224-150246 CAGTCCAGACACAGGCAGGGCGG + Intergenic
1019800781 7:3086865-3086887 CAGACTAAACTCAGCCAGCGAGG - Intergenic
1021869336 7:24988098-24988120 AACACTATACACAGACATGGAGG - Intergenic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1024044943 7:45579876-45579898 AACACTAAACACAGGCCTGGGGG - Intronic
1025617148 7:63130624-63130646 CAGGCTAAACACAGGGAATGAGG + Intergenic
1026426688 7:70301909-70301931 AAAACAAAACACAGGCATCGTGG - Intronic
1026609510 7:71845370-71845392 TAAACGAAACACAGGCATGAAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1031100321 7:117471789-117471811 CAGTCTTAAAACAGGAATGGGGG + Intronic
1034543762 7:151776680-151776702 CAGACCACACTCAGGCCTGGAGG + Intronic
1035447936 7:158955810-158955832 CAGAATAAACACAGCCCTGTGGG + Intronic
1035821566 8:2598320-2598342 CAGACCAAGCACAGGTATGTGGG + Intergenic
1035860686 8:3024687-3024709 CAGAGAAAACACAGGCAATGTGG - Intronic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1035987139 8:4446703-4446725 CACACACAACTCAGGCATGGTGG - Intronic
1036590700 8:10165486-10165508 GAGACTAAAGACAGGCAAGGGGG + Intronic
1039801480 8:40960440-40960462 CAGTCCAAAGCCAGGCATGGTGG + Intergenic
1040012800 8:42676359-42676381 CAGGCAAGACAAAGGCATGGAGG - Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042925029 8:73958243-73958265 AAGACCAAAGCCAGGCATGGTGG - Intronic
1044726542 8:95199053-95199075 CAGATTTAAACCAGGCATGGTGG - Intergenic
1045237925 8:100372366-100372388 AAGAGTAAAGCCAGGCATGGTGG - Intronic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1046008078 8:108510030-108510052 CACACCAAAGCCAGGCATGGTGG - Intergenic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1048544221 8:135371191-135371213 TAGACTAAAGGCAGACATGGAGG + Intergenic
1050723169 9:8614423-8614445 CAAACTGAATACAGGCAGGGAGG - Intronic
1053010640 9:34630912-34630934 CACACCAAACAAAGCCATGGGGG - Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1059976684 9:119725189-119725211 CAGACAAAACAAAAGCTTGGAGG - Intergenic
1060647349 9:125292367-125292389 CAGACTAAACTAAGACTTGGTGG + Intronic
1061534923 9:131241651-131241673 CAGGCTAAGGGCAGGCATGGTGG + Intergenic
1062338367 9:136082400-136082422 CAGACCTCTCACAGGCATGGTGG - Intronic
1062701425 9:137906828-137906850 AAGACTAGACACAGGCATGCAGG - Intronic
1203709789 Un_KI270742v1:87322-87344 CAGACGAAGGCCAGGCATGGTGG + Intergenic
1187758800 X:22557182-22557204 CAAACAAAAAACAGGTATGGTGG - Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1188809303 X:34633250-34633272 CAGACAGAACACAGGGATGAGGG + Intronic
1188853276 X:35158728-35158750 AAGACTGTACCCAGGCATGGTGG + Intergenic
1189092355 X:38099011-38099033 CTGACTGCAAACAGGCATGGGGG + Intronic
1189395031 X:40613751-40613773 CACACTGAGGACAGGCATGGTGG + Intergenic
1190025017 X:46914025-46914047 CAGACTGAACACAGGGAATGAGG - Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1199322071 X:146451687-146451709 CAAATTAAACACAAGCATGCAGG + Intergenic
1199343133 X:146706112-146706134 AAGACTGACCACAGGCTTGGTGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1200967303 Y:9108993-9109015 CATAATAAACACTGGCCTGGAGG - Intergenic
1202334284 Y:23790554-23790576 GTGACGAAATACAGGCATGGTGG - Intergenic
1202536484 Y:25879505-25879527 GTGACGAAATACAGGCATGGTGG + Intergenic