ID: 1104419678

View in Genome Browser
Species Human (GRCh38)
Location 12:128625008-128625030
Sequence GACCCTATGCTTGTGCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104419672_1104419678 5 Left 1104419672 12:128624980-128625002 CCGAGAGAAACTAGCAAGGGAGG 0: 1
1: 0
2: 3
3: 24
4: 211
Right 1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1104419668_1104419678 30 Left 1104419668 12:128624955-128624977 CCACTGGAATGTAAGAAACACAG 0: 1
1: 0
2: 2
3: 28
4: 248
Right 1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1104419671_1104419678 6 Left 1104419671 12:128624979-128625001 CCCGAGAGAAACTAGCAAGGGAG 0: 1
1: 0
2: 0
3: 112
4: 6145
Right 1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104419678 Original CRISPR GACCCTATGCTTGTGCCAAT AGG Intronic
916218113 1:162416130-162416152 GACCCTATTCTTCTGGCCATGGG + Intergenic
920472487 1:206243506-206243528 GCCCCTATGCTAGAGCCAAGAGG + Intronic
920609275 1:207421878-207421900 GACCCTATGCTTTCACCATTAGG - Intergenic
1073636196 10:105201220-105201242 AACCCTGTGTCTGTGCCAATTGG + Exonic
1092532832 12:9359848-9359870 GCCCCAAAGCTTGTGGCAATTGG + Intergenic
1099174627 12:79406651-79406673 GACTCTAAGCCTGTGCTAATTGG - Intronic
1103894500 12:124264180-124264202 GACACTAAGCTTGTTCCACTGGG + Intronic
1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG + Intronic
1107969603 13:45628578-45628600 GCCCCAATGCTGGTGGCAATTGG + Intergenic
1108872833 13:55007738-55007760 GGCCATAGGCTTGTGCCATTTGG - Intergenic
1110548204 13:76780681-76780703 GAGCCTATGCTTTTCCCACTAGG + Intergenic
1118612832 14:67554816-67554838 GTCCCTTTGCTTGGGCCACTTGG + Intronic
1120836562 14:89043097-89043119 GACACTATGTTTGTGGTAATTGG + Intergenic
1131152456 15:90055554-90055576 AGCCTTATGCTTGTACCAATCGG - Intronic
1138875748 16:60947113-60947135 GACTTCATGCTTGTGACAATTGG - Intergenic
1146672322 17:34749565-34749587 GGCCAAATACTTGTGCCAATAGG - Intergenic
1151611397 17:75178018-75178040 GACTATAGGCTTGTGCCACTGGG - Intergenic
1152083778 17:78205152-78205174 GACCCCATGCTTGGTCCAGTCGG - Exonic
1152615096 17:81334246-81334268 GACCCTGTGCCTGTGCCTAATGG - Intergenic
1157823303 18:50789743-50789765 GACCATAGGCATGTGCCACTGGG + Intergenic
1157840566 18:50954719-50954741 GATCCTATGCTTGTGTCTCTTGG + Intergenic
1165330203 19:35137418-35137440 CACCCTATGCTTGAGCAAACAGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
929258897 2:39843050-39843072 GAGCCTAAGCTAATGCCAATAGG - Intergenic
936458627 2:112694421-112694443 GACCCTAGGCTGCTGCCAGTTGG + Intergenic
944291910 2:198017662-198017684 GAATCTCTGCTTTTGCCAATAGG + Intronic
1170953321 20:20956080-20956102 GACACTATGCTGGTGACAATTGG + Intergenic
1181051507 22:20240289-20240311 GACCCTGTGCCTGTGCCCACAGG - Intergenic
1183836607 22:40459287-40459309 GACCCTATCCATGTACCAACAGG + Intronic
1185105422 22:48866798-48866820 GACCCTAAGCTGGAGCCAAGTGG + Intergenic
949953005 3:9244809-9244831 GACCCCATGCTGGTGCCAAATGG - Intronic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
959709660 3:109372560-109372582 GACCCTAAGAATGTGCCATTTGG + Intergenic
978907163 4:114019719-114019741 GTTCCTATGCTTGTGCCAACTGG + Intergenic
984911840 4:184680903-184680925 GACCTTATTCTGGTGCCAATAGG - Intronic
986560930 5:9060397-9060419 GACCCTATCCTTGTTGCCATGGG - Intronic
986565882 5:9113487-9113509 GACGTGATGCATGTGCCAATTGG + Intronic
993736966 5:91488938-91488960 CACCCTATGCTGGTGGCAAGAGG - Intergenic
1008035804 6:46743915-46743937 GTCCCAGTGCTTGAGCCAATGGG + Intergenic
1010025403 6:71209879-71209901 AACACTATGCTAATGCCAATAGG + Intergenic
1017329297 6:153177009-153177031 AACCCAATGCTTGTACCAATTGG + Intergenic
1021947242 7:25740219-25740241 CACCCTCTGCTTGTGTGAATTGG + Intergenic
1023706103 7:42943256-42943278 TACCCAATGATTGTGGCAATTGG + Intronic
1024121764 7:46249032-46249054 GCCCCTATGCCTATGGCAATGGG + Intergenic
1036260150 8:7233185-7233207 GACACTATGCCTGGGGCAATGGG + Intergenic
1036312187 8:7691741-7691763 GACACTATGCCTGGGGCAATGGG + Intergenic
1036687122 8:10919075-10919097 TCCCCTATGCTTTTCCCAATTGG + Intronic
1038291104 8:26250627-26250649 GAGCCTCTGGTTGTGCCATTTGG + Intergenic
1042105276 8:65319695-65319717 GTGCCTAGGTTTGTGCCAATAGG - Intergenic
1187055651 X:15739074-15739096 GCCCCGAGGCTTGTGGCAATTGG + Intronic
1192270244 X:69572509-69572531 GACCCTATGCTGGGCCCTATAGG - Intergenic
1197751303 X:129965557-129965579 GACCCTTTGTATGTGCCATTTGG - Intergenic