ID: 1104420144

View in Genome Browser
Species Human (GRCh38)
Location 12:128628195-128628217
Sequence CTGTGAGGAAGGGGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104420144_1104420150 -6 Left 1104420144 12:128628195-128628217 CCCTGGGAGCCCCTTCCTCACAG 0: 1
1: 0
2: 3
3: 61
4: 398
Right 1104420150 12:128628212-128628234 TCACAGTAACAGCCTTGAACCGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104420144 Original CRISPR CTGTGAGGAAGGGGCTCCCA GGG (reversed) Intronic
900772826 1:4559323-4559345 CTGAGAGGAAGGGGCTGCTCGGG + Intergenic
900863826 1:5253131-5253153 TTGTGAGGAAGGGGTTGACATGG + Intergenic
900934873 1:5758924-5758946 CTCTGAGGCAGGAACTCCCAGGG - Intergenic
901031854 1:6311761-6311783 CTGTGAGAAAGGGGCGCTCCTGG - Intronic
903324441 1:22562058-22562080 CTGCGAGGAAGGGGCTCCTATGG + Intergenic
904826295 1:33275966-33275988 CTGTGAGGCTGGGGGACCCACGG + Intronic
905001953 1:34679628-34679650 ATGTAAGGAGTGGGCTCCCAAGG + Intergenic
905174668 1:36127948-36127970 TTGTGGGAAAGGGACTCCCATGG + Intergenic
908941898 1:69445332-69445354 CAGTGAGGAAGGGGCTTCATTGG - Intergenic
910158917 1:84252890-84252912 CTGAGAGGAAGGGGAACTCAAGG - Intergenic
910909477 1:92218221-92218243 CGGTGTGGAAAGGGCTCCCTCGG + Intronic
911708262 1:101040286-101040308 ATGCAAGGAATGGGCTCCCAAGG + Intergenic
911730167 1:101284138-101284160 CTGTGAGGAAGGAGGTGCCTCGG + Intergenic
911835551 1:102614479-102614501 CTTTGGGGAATGGGCACCCATGG - Intergenic
912374280 1:109197805-109197827 CTGTGTGCAAAGTGCTCCCAGGG + Intronic
916496124 1:165348955-165348977 CTCTGAGGAAAGGTTTCCCAAGG + Intronic
916726728 1:167530143-167530165 CTGTGAGAAATGGGATCCTAAGG - Intronic
917118198 1:171623433-171623455 CTGTGAGAAAAGGGCTCCTCTGG + Intergenic
917355089 1:174119268-174119290 CTGTGAAGGAGGGCTTCCCAAGG - Intergenic
917836138 1:178942946-178942968 CTGGGAGGGAAGGGCTGCCAGGG + Intergenic
918485793 1:185027154-185027176 ATGCAAGGAATGGGCTCCCAAGG + Intergenic
919727676 1:200894734-200894756 CAGGGAAAAAGGGGCTCCCATGG - Intronic
920283081 1:204858785-204858807 CGGTGGGGAAGGAGCTGCCATGG - Intronic
920376906 1:205513726-205513748 CTGTGGGGAAGGGGTTCGGAGGG - Intronic
920398032 1:205660603-205660625 CTGTTAGGAAGGGGCCTCCCAGG + Intronic
920442362 1:205989544-205989566 CTGAGAGGAAGAGGCTGACATGG - Intronic
920502376 1:206493409-206493431 CTGTGTGGAAGGGGGTTGCAGGG + Intronic
921269622 1:213455921-213455943 TGGTGAGGAAGGGGCTCCTGGGG - Intergenic
924902136 1:248412179-248412201 GTGTAAGGGATGGGCTCCCAAGG - Intergenic
1063081556 10:2772574-2772596 TTGTGAGGAATTGGCGCCCAGGG - Intergenic
1063488155 10:6439161-6439183 GTGTGAGCCAGGAGCTCCCAAGG - Intronic
1063881466 10:10536912-10536934 CTCTGAGGAGGGGGCTCCACTGG + Intergenic
1066209645 10:33224247-33224269 CTGTGTGCCAGGGGTTCCCAGGG + Intronic
1066227166 10:33394462-33394484 CAGAGAGAAAGGGGCTTCCAGGG + Intergenic
1066521234 10:36222102-36222124 CAGTCAGAAAGGGGTTCCCAGGG + Intergenic
1067385500 10:45814667-45814689 ATGTCAGGAAGGGGCTCTCCTGG - Intergenic
1067790435 10:49283590-49283612 CTCCGGGGAAGGGGCTCACAGGG + Intergenic
1068092918 10:52455003-52455025 CTGTGAGGAGGGGGCACAGAGGG - Intergenic
1068432367 10:56949389-56949411 GTGTGAGGGCTGGGCTCCCAAGG - Intergenic
1069560608 10:69426765-69426787 CTGTGAGTAAGGGTCTCCTTTGG - Intergenic
1069574648 10:69517762-69517784 CTGTGAGGAGGGCTCTGCCAGGG + Intergenic
1069630439 10:69894225-69894247 ATGTGAGGTAGGGGGTCCCATGG + Intronic
1069711114 10:70489201-70489223 CTCTGAGGAAGGGGCTGCCTGGG + Intronic
1070349878 10:75581999-75582021 ATGTGAGGGGTGGGCTCCCAAGG + Intronic
1072805922 10:98424041-98424063 CTGGGAGTGAGGGGCTCCCCAGG - Intronic
1072914186 10:99527067-99527089 CAGAGAGGAAGGGGCTACGAGGG + Intergenic
1073149981 10:101304995-101305017 AGGTGGGGAAGGGGGTCCCAGGG - Intergenic
1073341044 10:102744538-102744560 CTGTGAGGGAGGGGATCCTGAGG + Intronic
1074737694 10:116453098-116453120 GTGTGAGGAGTGGGATCCCAAGG - Intronic
1075085903 10:119414092-119414114 CTGGAAGAAAGGGGCTCCCAGGG - Intronic
1076294209 10:129371876-129371898 CCGCCAGGAAGGGGCTCCCCAGG - Intergenic
1076506988 10:130984815-130984837 GTGGAAGGAAGGGGCTCTCAGGG - Intergenic
1076701997 10:132278087-132278109 GTGTGAGCAATGGGTTCCCAGGG - Intronic
1076705701 10:132300370-132300392 CTGTGAGGAGGGAGCCCCCATGG - Intronic
1076849229 10:133084922-133084944 CAGTGAGGAAGCGGCTCACGCGG - Intronic
1077059806 11:613144-613166 CTGGCAGGCAGGTGCTCCCAAGG + Intronic
1077379015 11:2219543-2219565 CTGTGGGAATGGGGCTGCCAGGG - Intergenic
1077906779 11:6540266-6540288 GTGAGGGGAAGGGGATCCCAAGG - Intronic
1078364084 11:10692559-10692581 CTGTGAGGCTGGGGGTCCAAAGG - Intronic
1078622669 11:12923378-12923400 CGGTGAGGAGTGGGCCCCCAGGG - Intronic
1078991169 11:16647933-16647955 TTGTGGGGGAGGGGCTCACAGGG + Intronic
1080351689 11:31392602-31392624 CTGTGAGGCAGGGCCTTTCAAGG + Intronic
1080453714 11:32399834-32399856 CAGTGAAGAAGAGGCTGCCAGGG + Intronic
1081547217 11:44079970-44079992 CTGTGTGTAAGGGGCTCCAGAGG - Intronic
1082948801 11:58788773-58788795 GTATGAGGGATGGGCTCCCAAGG + Intergenic
1083733661 11:64667571-64667593 CTGTGAGGATGTGGCTGCCCTGG - Exonic
1083985646 11:66213304-66213326 CTGGCATGAAGGGGCTCCCATGG - Intronic
1084519207 11:69653167-69653189 GTGTGAGGAGGAGGCTCCCGAGG + Exonic
1084652152 11:70495633-70495655 CTGTCAGGAAGCAGGTCCCAGGG - Intronic
1084717086 11:70880823-70880845 CTGAGAGGATAGAGCTCCCAGGG + Intronic
1084770855 11:71342056-71342078 CTTTGAGGAAGGGGGTGACATGG + Intergenic
1084835789 11:71801051-71801073 CTGAGAGGAGGGTGCTCACAGGG - Exonic
1085145507 11:74192133-74192155 GTGTGAGGGGTGGGCTCCCAAGG - Intronic
1085636255 11:78161625-78161647 CAGTGAGGAAGGGGCTAAGAGGG - Intergenic
1086817813 11:91394844-91394866 TTGTGAGGAAGTGGCTAGCAGGG - Intergenic
1088454006 11:110014567-110014589 ATGCAAGGAGGGGGCTCCCAAGG + Intergenic
1088598522 11:111456811-111456833 CTCTCAGGAATGAGCTCCCAGGG + Intronic
1089402574 11:118172936-118172958 CTGGGAGGCAGGGGCTGCCCCGG - Intronic
1089780429 11:120869799-120869821 CTGAGAGGAAAGGGATCCCCAGG + Intronic
1090073625 11:123564869-123564891 TTTTGAGGAAGGGGCTTCCTGGG + Intronic
1090125029 11:124076012-124076034 CTGGGAGGGTGGGGCTCCCCTGG + Intergenic
1090206189 11:124885653-124885675 ATGTGGGGAAGGGACACCCAAGG + Intronic
1091025282 11:132136053-132136075 CTGAGAGGAAGGGGTCCCCAGGG - Intronic
1091669606 12:2443373-2443395 GTGTGAGGGGTGGGCTCCCAAGG + Intronic
1091696405 12:2630920-2630942 ATGGGAGGAGGGGGCTCCCATGG + Intronic
1093012823 12:14126821-14126843 GTGTGAGGAATGGGTTCCCAAGG + Intergenic
1096582342 12:52594161-52594183 TTTTGAGGAGGGGGCTTCCAGGG - Intronic
1096599391 12:52718560-52718582 ATGTGAGGAAGGGGGTCTGAGGG + Intergenic
1098644343 12:72880121-72880143 GTGTGAGGAGTGAGCTCCCAAGG + Intergenic
1098939473 12:76518324-76518346 GTGTGAGGGGTGGGCTCCCAAGG + Intronic
1099559000 12:84149061-84149083 ATGAGAGGAGGGGCCTCCCAGGG - Intergenic
1099608209 12:84832312-84832334 TTCTGAGGAAGGGGTGCCCAAGG - Intergenic
1101063492 12:100995816-100995838 CTGGGAGCAAGGGGCACCCAGGG + Intronic
1101633897 12:106521447-106521469 ATGAGAGGCAGGGGCTGCCAAGG + Intronic
1102202819 12:111069282-111069304 CTGAGAGGAAGGGTCAGCCAGGG - Intronic
1102589336 12:113945720-113945742 CTGTGAGGCTGGGGCCGCCAGGG - Intronic
1103482774 12:121261605-121261627 CTGTGGGGAAGGCACACCCAGGG + Intronic
1103503948 12:121427727-121427749 CTGCTAGGGAGGGGCTGCCAGGG - Intronic
1103974114 12:124690817-124690839 CTGTGAGGAAGGGATTACCACGG - Intergenic
1104420144 12:128628195-128628217 CTGTGAGGAAGGGGCTCCCAGGG - Intronic
1106130630 13:26936434-26936456 GTGTGAGGAGTAGGCTCCCAAGG - Intergenic
1106620098 13:31364563-31364585 CTGAGAGGAACAGGCACCCAGGG + Intergenic
1107999286 13:45891597-45891619 CTGTGGGGCAGGGGCTGCCAAGG + Intergenic
1108275142 13:48800729-48800751 CTGGGAGGAAGGGCATGCCAAGG + Intergenic
1108612471 13:52097432-52097454 GTGTGAGGAGTGGGCTCTCAAGG - Intronic
1109088064 13:58001582-58001604 TTGTGTGGAAGAGGCTTCCATGG - Intergenic
1109563053 13:64077267-64077289 CAGTGTGGAAGGGGACCCCAGGG + Intergenic
1110065998 13:71106080-71106102 CTGAGAGGAAGGAGCTTCCCAGG + Intergenic
1110829471 13:80013509-80013531 TTGTGTGGAAAGGGATCCCACGG - Intergenic
1111419905 13:87998782-87998804 GTGTGAGGGGTGGGCTCCCAAGG - Intergenic
1111591171 13:90349369-90349391 CAGTGTGGAAGGGGACCCCAGGG - Intergenic
1111928907 13:94493420-94493442 CTGTGAGAAAGGAATTCCCAAGG + Intergenic
1112845227 13:103634468-103634490 CTGTTAGGAAGGGGAACTCAGGG + Intergenic
1113542342 13:111118618-111118640 TTGTGAGAAAAGGGCTTCCAGGG - Intronic
1113840098 13:113354299-113354321 CAGTGGGGAGGGGGCTCCCAAGG - Intronic
1115786574 14:36833330-36833352 CAGTGAGCAAGGTGCTCCCTGGG + Intronic
1120841677 14:89091118-89091140 TTGTGAGGGTGGGGGTCCCATGG - Intergenic
1121024672 14:90606653-90606675 GTGGGAGGAAGGGACGCCCAAGG + Intronic
1121678120 14:95770979-95771001 CTGTCAGGAAGTGGCACCCTTGG + Intergenic
1121732722 14:96197709-96197731 CTGTGAGGAAGGGAGTCCAGGGG + Intergenic
1122034257 14:98935986-98936008 CTGGGTGGAAGGGGCTGCCGGGG + Intergenic
1122345300 14:101054902-101054924 CAGTGGTGAAGGGGCTGCCAAGG - Intergenic
1122775453 14:104114973-104114995 CTGTGGGGAGGCGGGTCCCACGG - Exonic
1122896300 14:104759050-104759072 CTGAGAGGAAGGTGCTGGCAGGG + Intronic
1123099919 14:105790678-105790700 GTGTGAGGAGCGGGTTCCCAAGG - Intergenic
1123192283 14:106582941-106582963 CTGTCTGGGAGGAGCTCCCAGGG - Intergenic
1202834038 14_GL000009v2_random:64683-64705 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1124696260 15:31867148-31867170 CTGCGAGGAAAAGTCTCCCAGGG + Intronic
1125329167 15:38565126-38565148 CTGCGGGAAAGGGGGTCCCATGG - Intronic
1126105024 15:45141844-45141866 CTGAGGGGAAGGGGCTGCCTTGG - Intronic
1127692931 15:61415397-61415419 CTGCAAGGAGCGGGCTCCCAAGG + Intergenic
1128925173 15:71648758-71648780 GTGTGAAAAAGGGGATCCCATGG + Intronic
1129188270 15:73923431-73923453 CTGTGTTGCCGGGGCTCCCACGG - Intergenic
1129701982 15:77773529-77773551 CTGGGAGGGATGGGCTTCCAGGG - Intronic
1130379058 15:83356463-83356485 ATGTGAGGAATCGGCTCCTATGG - Intergenic
1131568402 15:93506796-93506818 GGGTGAGGAAGGGGCTTCCTGGG + Intergenic
1132601361 16:774553-774575 CAGAGGGGCAGGGGCTCCCAGGG - Intronic
1132631508 16:919876-919898 CTCGGAGGAAGGGGGTCCCGGGG - Intronic
1132654596 16:1036561-1036583 CTGTGAAGGAGGGGTTCCCCGGG + Intergenic
1132654617 16:1036621-1036643 CTGTGAAGGAGGGGTTCCCCGGG + Intergenic
1132847240 16:2006265-2006287 CTGTGAGCAAGGTGGGCCCAAGG + Intronic
1132955742 16:2592411-2592433 CAGGGAGGAAAGGGCTCTCAGGG + Intronic
1133233378 16:4376746-4376768 CTGTGCTGAAGGGGCCGCCAAGG + Intronic
1136016725 16:27405601-27405623 ATGTGAGGAAGGGGCTGCGAGGG - Intronic
1136235043 16:28908551-28908573 CTGGGAAGAAGGGGCCCTCACGG + Intronic
1136688234 16:32008712-32008734 CTGTAGGGAAGGGGCTGCCTTGG + Intergenic
1136788836 16:32952267-32952289 CTGTAGGGAAGGGGCTGCCTTGG + Intergenic
1136880976 16:33901667-33901689 CTGTAGGGAAGGGGCTGCCTTGG - Intergenic
1137028397 16:35500536-35500558 CTGTGAGGATGGGGCTAGAAGGG - Intergenic
1138030566 16:53556434-53556456 CAGTGAGGAGGGGGCGCCCCAGG - Intergenic
1139029643 16:62863658-62863680 CTGTTAGGGAAGTGCTCCCAAGG + Intergenic
1139270778 16:65680790-65680812 CTGGGAGGTAGAGGCTGCCATGG + Intergenic
1139390093 16:66601856-66601878 CTGTGGGAAAGGGGGTCCCAGGG + Intergenic
1141962725 16:87420388-87420410 GTGTGAGGAAGGGAATTCCAGGG - Intronic
1142425084 16:89998008-89998030 CTGTGAGGAAGGGTCTCCTGGGG + Intergenic
1203091033 16_KI270728v1_random:1213756-1213778 CTGTAGGGAAGGGGCTGCCTTGG + Intergenic
1142919517 17:3171979-3172001 ATATGAGGAATGGCCTCCCAAGG - Intergenic
1143151064 17:4807784-4807806 CAGTGGGGAAGAGGCTCTCAGGG - Exonic
1143778949 17:9219388-9219410 GTGTCATGAAGGGGCTCCGAGGG + Intronic
1143852948 17:9826204-9826226 GAGTGAGGAAGGGCCTCCCAGGG - Exonic
1144050119 17:11491046-11491068 CTGGGCTGAAGGGGCTCCAAAGG - Intronic
1144771663 17:17762876-17762898 CTGAAAGCAAGAGGCTCCCATGG + Intronic
1146341076 17:32020561-32020583 CTATTAGGTAGGGGCTGCCAGGG - Intronic
1146813024 17:35918566-35918588 CTATTAGGTAGGGGCTGCCAGGG + Intronic
1147149226 17:38504418-38504440 CTGTAAGGAAGGGGCTGCCTCGG + Intronic
1147254668 17:39174696-39174718 CTGGGAGGAAGGGGCAGGCAGGG + Exonic
1147922743 17:43927930-43927952 CTGTTAGGTAGGGGCTGCCAGGG + Intergenic
1147999800 17:44380939-44380961 CTGTGGGGAAGGGGCTGTCCAGG + Exonic
1148174378 17:45550830-45550852 CTATTAGGTAGGGGCTGCCAGGG + Intergenic
1148274884 17:46294617-46294639 CTATTAGGTAGGGGCTGCCAGGG - Intronic
1148296991 17:46512196-46512218 CTATTAGGTAGGGGCTGCCAGGG - Intronic
1148361545 17:47016676-47016698 CTATTAGGTAGGGGCTGCCAGGG - Intronic
1148646782 17:49223924-49223946 CTGGGAGGAAGGGGCCCCCCCGG - Exonic
1149783263 17:59414972-59414994 GTGTGAGGAAGAGCTTCCCAGGG + Intergenic
1150405597 17:64897752-64897774 CTATTAGGTAGGGGCTGCCAGGG + Intronic
1150495413 17:65604328-65604350 CTGGGAGGAAGGGGATCCCCTGG + Intronic
1151357339 17:73567651-73567673 GTGTGAGGGTTGGGCTCCCAAGG - Intronic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151715025 17:75826954-75826976 CAGTGAGCAGGGGCCTCCCAGGG - Intergenic
1152267430 17:79304018-79304040 CTGTGAGAAATGGGCTCCCTGGG - Intronic
1152447310 17:80353322-80353344 CTGGAAGGAAGGGGCTGCCTTGG + Intronic
1153054182 18:929302-929324 CTGTGAAGAAGAGGTTTCCACGG - Intergenic
1154423986 18:14258175-14258197 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1154431241 18:14310125-14310147 GTGTGAGGTCTGGGCTCCCAAGG - Intergenic
1156465837 18:37347482-37347504 CTGTGAGGCAGGGCCTCTCTGGG - Intronic
1157110497 18:44816112-44816134 AGGTGAGGGAGGGGCTCCAAGGG + Intronic
1157331299 18:46705648-46705670 CTGTGAGGAGAGGGCTCACCGGG - Intronic
1157474482 18:48012541-48012563 CAGGGAGGAAGGGGCTCAGAGGG - Intergenic
1157786058 18:50483673-50483695 CTGTGATGAGTGCGCTCCCATGG + Intergenic
1157901619 18:51523522-51523544 CTGTCAGGAAGTGGAGCCCAAGG - Intergenic
1159085094 18:63781169-63781191 GGGTGAGGAAGGGGGTCACAAGG - Intronic
1159122671 18:64188960-64188982 CTGTAAGGAAGGAGATCACAAGG + Intergenic
1160387185 18:78503785-78503807 GTGGGAGCCAGGGGCTCCCAGGG + Intergenic
1160409609 18:78666915-78666937 CTGGGAGGCAGGGGCAGCCAAGG + Intergenic
1160429760 18:78803414-78803436 GAGTGCAGAAGGGGCTCCCAGGG + Intergenic
1160567055 18:79792773-79792795 CAGTGCGGGAGGAGCTCCCACGG - Intergenic
1160745913 19:710503-710525 CTGTGGGGAGGGGGCTGCCTAGG + Intronic
1160764048 19:799176-799198 CTGGGAGGGAGGGGCGCCAAAGG + Intronic
1160864798 19:1251908-1251930 CTGTTAGGAAGGGGCTGGCGAGG - Intronic
1161404108 19:4082138-4082160 CTGACAGGAAGGGTCTCCCGAGG + Intergenic
1161492679 19:4570895-4570917 AGGTGAGGAAGGTGCTCCAAGGG + Intergenic
1161513041 19:4682465-4682487 CTTGCAGGAAGGGGCACCCAGGG - Intronic
1161777669 19:6272559-6272581 ATGGGATGAAGGGGCTCCCGTGG - Intronic
1162302764 19:9853578-9853600 CTGGGGGGAAGGGGTTCCCCAGG - Intergenic
1163536916 19:17882176-17882198 CAGTGAGGACAGGGCTGCCACGG - Exonic
1163539718 19:17900614-17900636 CTGTAAGGGTGGGGCTCTCATGG + Intergenic
1163600088 19:18243762-18243784 GGGTAAGGATGGGGCTCCCAGGG + Intronic
1163857643 19:19717363-19717385 CTGTGAGGATGGCACACCCAGGG - Intronic
1163968279 19:20769063-20769085 CTGTGGGGTGGGGGCTCCCCAGG - Intronic
1165944969 19:39436470-39436492 CTGAGGGGAAGGGGCTCTGAGGG - Intronic
1166224400 19:41386110-41386132 ATGTGGGGAAGGAGCCCCCAGGG - Intronic
1167471564 19:49678693-49678715 CTGTCAGGATGCAGCTCCCAGGG + Intronic
1168185713 19:54698202-54698224 CTGAGAGGGAGGGTCTGCCAGGG - Intronic
1202638642 1_KI270706v1_random:63009-63031 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
925393190 2:3512950-3512972 GTGCAAGGAATGGGCTCCCAAGG - Intronic
925445966 2:3927264-3927286 CTGTGAGGAGGGGGCAGCCCGGG - Intergenic
925539575 2:4952230-4952252 ATGTGGGGTTGGGGCTCCCATGG - Intergenic
926159001 2:10474948-10474970 TTGGGAGGAAGGGGTTCCCCAGG + Intergenic
926233844 2:11024598-11024620 CTGTGGGGATGGGGCGGCCAAGG - Intergenic
926616469 2:15001909-15001931 CAGTGTGGAAGGGGACCCCAGGG + Intergenic
927578148 2:24217472-24217494 CTGTGAGGACAGGCCCCCCAAGG - Intronic
927961692 2:27244261-27244283 ATGTCAGGCAGAGGCTCCCAGGG - Intergenic
928024140 2:27726306-27726328 CTGTGGCCAAGGGGCTCCTAGGG + Intergenic
928301832 2:30131993-30132015 CTGAGTGGAAGGAGCTCACATGG - Intergenic
928880714 2:36093142-36093164 CAGTGTGGAAGGGGACCCCAGGG - Intergenic
930051563 2:47220028-47220050 TTGTGAGGAAGGGGCACACTTGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930304908 2:49665649-49665671 GTGGGAGGTAGGGGTTCCCAGGG + Intergenic
930978428 2:57492893-57492915 GTGTGAGGAAGGGGTTCTCCTGG - Intergenic
931205184 2:60139883-60139905 CTGTGAGAAAGGGGCTCCTCAGG + Intergenic
933746176 2:85572934-85572956 CTAGGAGGAAGGGGCTGGCATGG + Intronic
934492192 2:94769069-94769091 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
934493616 2:94779329-94779351 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
934494093 2:94782527-94782549 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
936156083 2:110048262-110048284 CTGAGTGCAAAGGGCTCCCAGGG - Intergenic
936188605 2:110323166-110323188 CTGAGTGCAAAGGGCTCCCAGGG + Intergenic
937223780 2:120356754-120356776 CTCTGGGGGAGGGGCTGCCAGGG + Intergenic
937462729 2:122103361-122103383 CTGTGAGGAGTGGGCTCCCAAGG + Intergenic
938069602 2:128301331-128301353 GTGTCAGGCAGGGGTTCCCAGGG + Intronic
938280056 2:130057454-130057476 CTGTGAGGGCTGGGCTCCCAAGG + Intergenic
938331013 2:130448169-130448191 CTGTGAGGGCTGGGCTCCCAAGG + Intergenic
938358935 2:130673334-130673356 CTGTGAGGGCTGGGCTCCCAAGG - Intergenic
940578261 2:155542695-155542717 GTGTGGGGAAGAGGATCCCAGGG - Intergenic
945083165 2:206106427-206106449 CTGGGAGGAAAGTGCTCACAAGG + Intergenic
945515818 2:210762466-210762488 CTGCAAGGAGTGGGCTCCCAAGG + Intergenic
947218191 2:227768185-227768207 CTGGGAGGAACGGGATTCCATGG - Intergenic
948080089 2:235198695-235198717 CTGGGTGGAAGGGGCTCACAGGG + Intergenic
948364975 2:237448875-237448897 ATGTGAGGGAGGGGCTGCCTGGG - Intergenic
1168926203 20:1581537-1581559 CCATGTGGAAGGAGCTCCCAAGG - Intronic
1169436052 20:5591837-5591859 GTGTGATGCAGGGGCTGCCATGG - Intronic
1170318694 20:15070081-15070103 GTGTGAGGGGTGGGCTCCCAAGG - Intronic
1170482021 20:16775301-16775323 ATGTGAAGAGTGGGCTCCCAAGG - Intergenic
1171210477 20:23312823-23312845 CTGTGATGGAGGTGTTCCCAGGG + Intergenic
1171883845 20:30637309-30637331 CTATGAGGCCTGGGCTCCCAAGG + Intergenic
1171885231 20:30647129-30647151 CTGTGAGGGCTGAGCTCCCAGGG + Intergenic
1172033186 20:31995661-31995683 CTATGAGGCAGGGGGTCCCCAGG - Intronic
1172093461 20:32449231-32449253 CTGTGGGGAAGGGACTCCAGGGG - Intronic
1173458411 20:43222346-43222368 CTCTGAGGAGGGGGCCCACAAGG + Intergenic
1174450532 20:50617319-50617341 CTGGGAAGAAGGGGCTGCCTTGG + Intronic
1175737628 20:61398382-61398404 CTGTGAGGCAGGGCTCCCCAGGG + Intronic
1176166224 20:63675384-63675406 GGGTGAGGACGGGGCTCCCCAGG - Intronic
1176845805 21:13875640-13875662 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
1176848540 21:13895194-13895216 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
1176849483 21:13901828-13901850 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
1177629076 21:23703265-23703287 CTTTTAGGAAGAGGCTCCCAGGG - Intergenic
1178205171 21:30456367-30456389 GTGTGAGGAACAGACTCCCAAGG + Intergenic
1179669505 21:42936577-42936599 CCTTGAGGAAGGGGCTGCCAGGG - Intergenic
1179678176 21:42999027-42999049 CTGTAAGGGCGGGGCTCTCATGG - Intronic
1179888012 21:44322688-44322710 CGGGCAGGAAGGGGTTCCCACGG + Intronic
1180363325 22:11918879-11918901 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1180858197 22:19061404-19061426 CTGCAGGGGAGGGGCTCCCAGGG - Intronic
1180968014 22:19800622-19800644 CCGGGAGGAAGGGTCTCCTAAGG - Intronic
1180996449 22:19968153-19968175 CTATGAGGGAGAGGCACCCAAGG - Intronic
1181038738 22:20182094-20182116 CTGCCAGCAAGGGGCCCCCAGGG - Intergenic
1181064491 22:20299166-20299188 GTGTGAGGCAGGGCTTCCCACGG + Intergenic
1181274875 22:21681970-21681992 CTGGCAAGAAGTGGCTCCCAAGG - Intronic
1181422298 22:22810499-22810521 GGGAGAGGATGGGGCTCCCAGGG + Intronic
1181636974 22:24178975-24178997 CTGGGAGGAGGGGGCTGTCAGGG + Intergenic
1182264924 22:29107060-29107082 CAGCGAGGAAAGGGCTCCCCTGG + Intronic
1182358540 22:29733712-29733734 CTCAGGGGAAGGGGCTCCCCAGG - Intronic
1182465578 22:30514214-30514236 CTGTGATGATGGTGCTCTCATGG + Intergenic
1182466432 22:30519773-30519795 CTGGAAGGAAGGGGCCCTCAGGG + Intergenic
1182735853 22:32532031-32532053 CGGAGAGGTAGGGGCTCACAGGG + Intronic
1183417536 22:37691168-37691190 CTGTGAGGGAGGAGATCCTAGGG - Exonic
1183440338 22:37819260-37819282 TTGTGGGCAGGGGGCTCCCAAGG + Intergenic
1183596964 22:38818706-38818728 GGGTGGGGAAGGGGCTCACATGG - Exonic
1183950088 22:41347921-41347943 GAGTGAGGAAGGGAATCCCAGGG - Intronic
1185154688 22:49186208-49186230 CTGTGAGAAGAAGGCTCCCAGGG - Intergenic
1185347211 22:50315824-50315846 CTGTGAGGCAGGGGCTGCTTGGG - Intronic
1185351294 22:50340860-50340882 CTGTGAGGCAAGAGCTCCTAGGG + Intergenic
950945450 3:16941087-16941109 CTAAGAGAAGGGGGCTCCCATGG + Intronic
951822457 3:26827638-26827660 TTGTGAGGGTGGGGCTACCAAGG - Intergenic
952972694 3:38662721-38662743 CAGTCAGGAAGAGGCTCCAAAGG - Intergenic
953173673 3:40529929-40529951 CTTTGTGGAAGGTTCTCCCAGGG + Intronic
953800422 3:46018583-46018605 GTGAAGGGAAGGGGCTCCCATGG - Exonic
954082474 3:48220728-48220750 CTAGGAGGAAGGGGCAGCCATGG + Intergenic
954421329 3:50420573-50420595 CTCTCAGGAAGGGGCTGCCAGGG - Intronic
955344566 3:58151526-58151548 CTATGAGGATGGGGCAGCCAGGG - Intronic
955930035 3:64047197-64047219 CTTTTAGGGAGGGGCTGCCAGGG - Intergenic
959995877 3:112679567-112679589 CTGGGAGGGAGGGACTCCCAAGG - Intergenic
961365902 3:126399037-126399059 GTGTGAGGGAGGGAGTCCCAGGG - Intronic
961674390 3:128555795-128555817 CTGTGAGGGGGGGGCGCCCGGGG + Intergenic
962378947 3:134881214-134881236 CTGGGAGGCAGAGGCTCCAAAGG + Intronic
966124239 3:176556801-176556823 CTGTGGGAATGGTGCTCCCAAGG - Intergenic
967865537 3:194187062-194187084 CTGTGTGCAGGGGCCTCCCACGG - Intergenic
967865685 3:194187988-194188010 CTGTGTGCAGGGGCCTCCCACGG + Intergenic
968350717 3:198049736-198049758 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
968485315 4:858110-858132 CTGTGTGGAGGAGGCTCCCACGG + Intronic
969612996 4:8237427-8237449 GTGTGAGGACGTGGCTCCCCGGG - Intronic
970665649 4:18333489-18333511 CTGAGAGGCAGGAACTCCCAAGG + Intergenic
971563701 4:28113626-28113648 CAGTGTGGAAGGGGACCCCAGGG - Intergenic
971852254 4:31997386-31997408 CAGTGTGGAAGGGGATCCAAGGG - Intergenic
972061781 4:34883272-34883294 GTGTGAGGAGTGGGCTCCCAAGG + Intergenic
972762628 4:42121961-42121983 CTGAGAGGAACAGGCTCCTAAGG + Intronic
973368884 4:49229397-49229419 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
973392162 4:49566018-49566040 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
973708547 4:53603225-53603247 CAGTGAGGAGTCGGCTCCCAAGG - Intronic
977378380 4:96237772-96237794 GTGTGAGGAGTGAGCTCCCAAGG - Intergenic
979298336 4:119057639-119057661 CTCGGAGGAAGGTGCTTCCAGGG + Exonic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981730554 4:147892677-147892699 CTCAGAGGAAGGGGGGCCCAAGG + Intronic
1202765980 4_GL000008v2_random:148868-148890 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
985582982 5:709536-709558 GTGTGAGGTGTGGGCTCCCAGGG - Intergenic
985596660 5:794787-794809 GTGTGAGGTGTGGGCTCCCAGGG - Intergenic
988558654 5:32260672-32260694 CAGTGGGGAAGGGCCTGCCAGGG - Intronic
990006126 5:50945861-50945883 GTGTGAGGGATGGGCTCCCAAGG - Intergenic
990445307 5:55888389-55888411 CTGGGAGGAAGAGGCTTCCGTGG + Intronic
991042862 5:62193669-62193691 GTGTGAAGGATGGGCTCCCAAGG - Intergenic
992010052 5:72516874-72516896 CAGTGTGGCAGGGGCTGCCATGG - Intergenic
994446459 5:99880042-99880064 CTGGGTGGTAGGGGCTCACAGGG - Intergenic
998294279 5:140952105-140952127 GTGTGAGGGATGGGCTCCCAAGG + Intronic
998366934 5:141637804-141637826 CTGAGAGGAAGGGGCTGCAGAGG + Exonic
999166206 5:149551401-149551423 CCGTGAAGAAGCGGCTCCCGGGG - Intronic
1000334981 5:160235500-160235522 GTGAGAGGAAGGGCCTCCCAGGG - Intronic
1001152571 5:169245121-169245143 CTTGGAGGAGGGAGCTCCCAGGG - Intronic
1001560401 5:172665456-172665478 CTGTCAGGGAGGGGCCTCCAGGG - Intronic
1001636385 5:173213377-173213399 ATCCCAGGAAGGGGCTCCCACGG - Intergenic
1002493554 5:179596845-179596867 CTGTGGGGAGGGAGCTCCCTAGG - Intronic
1002931217 6:1636609-1636631 CATGGAGGAACGGGCTCCCATGG + Intronic
1003053653 6:2801015-2801037 CTTTGTGGAAGGGGCTACCTGGG - Intergenic
1003134825 6:3426947-3426969 CTCTGAGGAAGGGCATCGCATGG + Intronic
1003310347 6:4964781-4964803 CTGTGAGGACAGGGCTCCTGGGG + Intergenic
1004055107 6:12128341-12128363 GTGTAAGGATGGGCCTCCCAAGG + Intronic
1004755719 6:18608314-18608336 GTGTGAGGGGTGGGCTCCCATGG + Intergenic
1004756677 6:18618010-18618032 GTGTGAAGATTGGGCTCCCAAGG + Intergenic
1006424835 6:33957470-33957492 GGGTGAGGAAGGGGCTCCTAGGG + Intergenic
1006894746 6:37460385-37460407 CTGTGAGGGAGGGGCTGCTCTGG + Intronic
1007164261 6:39817623-39817645 TTTTAAGGAATGGGCTCCCATGG + Intronic
1007339675 6:41182759-41182781 CTGTGGGGAAGGGTGTCACATGG - Intergenic
1007725784 6:43914899-43914921 CTCTGAGCAAGGGGCTTCCTGGG + Intergenic
1008013208 6:46490880-46490902 CAGTGGGGAAGGGGCTCCTTTGG + Intronic
1008208684 6:48694290-48694312 CCCTGAGGAATGGGCACCCATGG - Intergenic
1008236444 6:49057488-49057510 CTGTAAGGGATGGGCTCTCAAGG + Intergenic
1010083240 6:71887272-71887294 GTGTGGGGAAGGGGCTGCCAGGG + Intronic
1010277824 6:73990204-73990226 CAGTGTGGAAGGGGACCCCACGG + Intergenic
1010785455 6:79994498-79994520 GTGCAAGGAATGGGCTCCCAAGG - Intergenic
1011400846 6:86959811-86959833 CTATGAGGAAAGGGCTCCTATGG - Intronic
1013418730 6:109947339-109947361 CTGTGAGGCAGAGGAGCCCAGGG + Intergenic
1013456225 6:110331924-110331946 CTGAGGGGAAGAGGCTCCTATGG - Intronic
1014122394 6:117740244-117740266 GTGTGGGGATGGGGCACCCATGG - Intergenic
1015561404 6:134520179-134520201 CAGGGAGGAAGGGGGTCACAGGG + Intergenic
1018053929 6:160035578-160035600 CTGTGAACAAGGGCATCCCAGGG - Intronic
1018444564 6:163843397-163843419 TTGTGAGGAATGTGCTTCCATGG + Intergenic
1019063496 6:169275473-169275495 GTGCAAGGAATGGGCTCCCAAGG - Intergenic
1019262563 7:89681-89703 CTGTGAGAAAAGGGCTGCCCAGG - Intergenic
1019527360 7:1486778-1486800 CAGGGAGGAAGGGGCTCTCAGGG + Intronic
1019657043 7:2201406-2201428 TTGTGGGCTAGGGGCTCCCAGGG - Intronic
1019702219 7:2479531-2479553 TGGTGAGGAAGGGTGTCCCAGGG + Intergenic
1019771588 7:2886787-2886809 CTGAGAGGGAGGGTCTGCCAGGG + Intergenic
1022284210 7:28939620-28939642 CCGTCTGGAAGGGCCTCCCAAGG - Intergenic
1022469386 7:30672922-30672944 CCGTGAGGAAGCGTGTCCCAAGG - Intronic
1022712521 7:32865110-32865132 GTGCAAGGAATGGGCTCCCAAGG + Intergenic
1023968268 7:44974751-44974773 CTGTGAGATAGGCGCGCCCAGGG - Intronic
1024049393 7:45609283-45609305 CTGTGCAGGAGGGACTCCCAGGG + Intronic
1024291871 7:47810892-47810914 ATGTGGGGATGGGGCTCCTAAGG + Intronic
1024466052 7:49712156-49712178 CAGTGCGGAAGGGGATCCGAGGG - Intergenic
1024530040 7:50383948-50383970 CTGTGCAGAATGGGCACCCAGGG - Intronic
1026339608 7:69424131-69424153 CTGAGAGGAAGTGGCTGCCTGGG + Intergenic
1027753541 7:82182131-82182153 TTGTGAGTAATGGGCTCACAAGG - Intronic
1031719870 7:125160529-125160551 CTGTGAGGATAGGACTCCCATGG + Intergenic
1032162550 7:129521933-129521955 CTATGAGGAAGGAGCTGGCAGGG - Intergenic
1032474548 7:132203180-132203202 CTGTGAAGGAGGGGCTCAGAGGG + Intronic
1034501949 7:151456430-151456452 GTGTGAGGGGTGGGCTCCCACGG + Intergenic
1034711181 7:153192857-153192879 CCTTGAGGAAGGGGATCTCAAGG - Intergenic
1035903056 8:3478865-3478887 CTGGGACGAAGGGCCTCCCCAGG - Intronic
1036021716 8:4853821-4853843 CTGCAAGGAGTGGGCTCCCAAGG - Intronic
1036134146 8:6143561-6143583 ATGTCATGAAGGGGATCCCAGGG + Intergenic
1036687641 8:10922639-10922661 CTGTGAGGCAGGGACTCCCATGG + Intronic
1037415882 8:18649279-18649301 GTGTGAGGAGTGGGCTCCCAAGG - Intronic
1038148193 8:24917628-24917650 GAGTGAGGAAGTGGCTACCAAGG + Exonic
1038642893 8:29341659-29341681 CTGTGATGAAGTGGCTGCCGAGG - Intronic
1038864114 8:31420710-31420732 CAATGAGGATGGGGCTCCCATGG + Intergenic
1039614426 8:38943572-38943594 CTGTCAGGGAGGGGCACACAGGG + Intronic
1040102529 8:43518334-43518356 GTGTGAGGGCTGGGCTCCCAAGG - Intergenic
1041758453 8:61338813-61338835 CTGAGAGGAAGAGCCTCCCCGGG - Intronic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045791395 8:105988404-105988426 CTGCAAGGAGAGGGCTCCCAAGG - Intergenic
1046243752 8:111532079-111532101 CTGCCAGGATGGGGCTCTCATGG - Intergenic
1047424571 8:124733660-124733682 CAGTGAGGTAGGAACTCCCAAGG + Intergenic
1047742545 8:127818300-127818322 CTGAATAGAAGGGGCTCCCAAGG + Intergenic
1047923324 8:129657428-129657450 ATGTAAGGAGTGGGCTCCCAAGG + Intergenic
1049469440 8:142768893-142768915 CTGGGAGGCAGGGGCTGCCCAGG + Intronic
1049675651 8:143887714-143887736 CTGGGAGGAAGGGGCTGGCAAGG + Intergenic
1049761879 8:144335477-144335499 CTGTGAGCAAGGGACGCCCAAGG - Intronic
1049775474 8:144401899-144401921 CCGTGAGGTAGGGGCTTCCTGGG - Intronic
1050415266 9:5409677-5409699 GTGTGAGGGATGGGCTCCCAAGG - Intronic
1051362412 9:16293074-16293096 CTGTGTGCTGGGGGCTCCCATGG - Intergenic
1052314034 9:27097690-27097712 GTGCAAGGAATGGGCTCCCAAGG - Intergenic
1053621649 9:39825497-39825519 CTGTTCGGGAGAGGCTCCCAGGG - Intergenic
1053664413 9:40307543-40307565 GTGTGAGGGCTGGGCTCCCAAGG - Intronic
1053665818 9:40316830-40316852 GTGTGAGGGCTGGGCTCCCAAGG - Intronic
1053837583 9:42157359-42157381 CTGTTCGGGAGAGGCTCCCAGGG - Intergenic
1053883446 9:42618800-42618822 CTGTTCGGGAGAGGCTCCCAGGG + Intergenic
1053889223 9:42675499-42675521 CTGTTCGGGAGAGGCTCCCAGGG - Intergenic
1053915399 9:42941879-42941901 GTGTGAGGGCTGGGCTCCCAAGG - Intergenic
1054228244 9:62482905-62482927 CTGTTCGGGAGAGGCTCCCAGGG - Intergenic
1054376973 9:64456859-64456881 GTGTGAGGGCTGGGCTCCCAAGG - Intergenic
1054518793 9:66059453-66059475 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
1054520201 9:66068742-66068764 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
1056710728 9:88990705-88990727 GCGTGAGGAAGGGGGTCGCATGG + Intergenic
1056795245 9:89654755-89654777 CTCTGAGGAACCGGATCCCAGGG + Intergenic
1057014947 9:91643086-91643108 CTAAGAGGAAGGTGCTCCCAGGG + Intronic
1057132127 9:92661509-92661531 ATGTGAGGAAGGGGCTGGGAGGG - Intronic
1057677621 9:97148060-97148082 GTGTGAGGGCTGGGCTCCCAAGG + Intergenic
1057791294 9:98126843-98126865 ATGTGAGGACGGGGTGCCCACGG + Intronic
1057819932 9:98322732-98322754 CTATGAAGAAGGGTATCCCAGGG - Intronic
1058380181 9:104368954-104368976 CTGAGAGGTAGGAGCTCCCAGGG - Intergenic
1058585243 9:106500827-106500849 CAGTGTGGAAGGGGACCCCAGGG + Intergenic
1059414590 9:114155310-114155332 CAGAGAGGAAGGGGCTGCCCAGG - Intergenic
1060019632 9:120117859-120117881 GTGTGAGGGGTGGGCTCCCAAGG - Intergenic
1060508669 9:124216691-124216713 CTGTGGGGAAGGGGTGCACAGGG + Intergenic
1060883673 9:127135811-127135833 CTGTGGGGAAGGGGCATGCAAGG + Intronic
1061489511 9:130937528-130937550 CTGAGAGGAAGGGACCACCAAGG + Intronic
1061753563 9:132797449-132797471 CTGAGAGGAAGCGTCTCCCTTGG - Intronic
1061884606 9:133585280-133585302 GTGTGGGGAGGGGGCTCCCGGGG - Intronic
1062524497 9:136972772-136972794 CGGTGAGGGTGGGGCTGCCAAGG - Intergenic
1062561629 9:137144744-137144766 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561691 9:137144920-137144942 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561711 9:137144977-137144999 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561731 9:137145034-137145056 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561754 9:137145091-137145113 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561776 9:137145148-137145170 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561798 9:137145205-137145227 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561818 9:137145262-137145284 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561838 9:137145319-137145341 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1203546732 Un_KI270743v1:133757-133779 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
1185911203 X:3982562-3982584 CTGGGGGGAAGGGGCAGCCATGG + Intergenic
1187843242 X:23510011-23510033 GTGTGAGGGGTGGGCTCCCAAGG - Intergenic
1188540855 X:31248846-31248868 CAATGAGGGAGGGGCTCCGAGGG - Intronic
1190017185 X:46837012-46837034 CTGCGAGGCCGGGGTTCCCAGGG + Exonic
1190104105 X:47546425-47546447 ATGTTAGAAATGGGCTCCCACGG - Intergenic
1190735121 X:53250853-53250875 CCGTGAGGAAGGCACTCGCAGGG - Exonic
1191202910 X:57803621-57803643 CTGCAGGGAAGGGGCTCTCATGG + Intergenic
1191737950 X:64407136-64407158 GTGTGAGAAGTGGGCTCCCAAGG + Intergenic
1192251550 X:69417746-69417768 CAGTGTGGAAGGGGACCCCAGGG - Intergenic
1193801961 X:85946914-85946936 CTGTAAGGAGTGGGCTCCCAAGG - Intronic
1195035163 X:100965574-100965596 GTGTGAGGAGTGGGCTCCCAAGG - Intergenic
1196029095 X:111075856-111075878 GTATGAGGGATGGGCTCCCAAGG - Intronic
1197588825 X:128383777-128383799 CTGTGAGGAATGGCCTGCTAGGG - Intergenic
1199289561 X:146090699-146090721 CTGTGAGGGTTGGGCTCCCAAGG - Intergenic
1199929461 X:152503874-152503896 ATGTGAGGAGTGGGCTCCCAAGG + Intergenic
1200742099 Y:6864660-6864682 CTGTGGGGTGGGGGCTCCCCGGG + Intergenic
1200981645 Y:9268045-9268067 CTTTGTGGAAGAGACTCCCAAGG - Intergenic