ID: 1104424032

View in Genome Browser
Species Human (GRCh38)
Location 12:128659954-128659976
Sequence TCTCAGCTCCACCGCGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104424027_1104424032 9 Left 1104424027 12:128659922-128659944 CCAGGGGCTGGACCTCTCACTTG 0: 1
1: 1
2: 2
3: 22
4: 183
Right 1104424032 12:128659954-128659976 TCTCAGCTCCACCGCGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 124
1104424031_1104424032 -3 Left 1104424031 12:128659934-128659956 CCTCTCACTTGGGGTTCATATCT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1104424032 12:128659954-128659976 TCTCAGCTCCACCGCGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104424032 Original CRISPR TCTCAGCTCCACCGCGCTGC TGG Intronic
900246969 1:1640825-1640847 TCCCAGCTCCTCGGCCCTGCTGG + Intronic
900258191 1:1707957-1707979 TCCCAGCTCCTCGGCCCTGCTGG + Intronic
901022379 1:6261735-6261757 TCTGAGCACCACCGCCCAGCCGG + Intergenic
901435942 1:9247507-9247529 TCTCAGCTCCATGGCCCTCCAGG + Intronic
901810740 1:11765738-11765760 TCTTAGCTCCCTCCCGCTGCTGG + Intronic
903661842 1:24983222-24983244 TCTCAGCTCCAGAACGCTGGGGG + Intergenic
905914346 1:41674659-41674681 TCCCAGCCCCACCCGGCTGCCGG + Intronic
910034879 1:82777697-82777719 GCTCAGCTCCACCGCCTTTCAGG - Intergenic
912456792 1:109803467-109803489 ACTCAGCTCCAGAGCTCTGCAGG + Intergenic
914214046 1:145608231-145608253 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
914465990 1:147928634-147928656 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
915280865 1:154821332-154821354 TCTCAGGTCCACAGCAGTGCAGG + Intronic
917229580 1:172821826-172821848 TCTCACCACCACCTCTCTGCAGG + Intergenic
917795020 1:178527121-178527143 TCTGAGCTCCACAGCACTCCAGG - Intronic
919896553 1:202012885-202012907 CCTCTGCTCAACCACGCTGCTGG - Intronic
920275170 1:204799187-204799209 CCGCAGCTCCACCCTGCTGCAGG + Intergenic
921265674 1:213418869-213418891 ACTCAGCTCCCCCCAGCTGCAGG + Intergenic
921364129 1:214357871-214357893 ACCCAGCTCCATCGCGCTGGAGG - Exonic
922758369 1:228109201-228109223 TCTTAGTTCCACCGGGCAGCGGG - Exonic
924570685 1:245235008-245235030 TCTCAGCTCCACCAGGCAGGAGG - Intronic
1063981363 10:11454526-11454548 ACTCAGCTCCACATCGCTCCTGG + Intronic
1066371841 10:34824298-34824320 TCTCAGCTCCACACCATTGCTGG - Intergenic
1067257624 10:44659744-44659766 TCTCAGCTCCATCCCACTTCAGG + Intergenic
1069854829 10:71434329-71434351 TCTCAGCTCCCCCAGGGTGCGGG + Intronic
1070055081 10:72926475-72926497 TCTCAGCTCCACAGAGCCCCTGG + Intronic
1072913424 10:99522812-99522834 TCCCGGCTCCGCCGTGCTGCAGG + Intergenic
1075657098 10:124169220-124169242 CCTCAGCTCCAGCGTCCTGCGGG + Intergenic
1075741278 10:124697940-124697962 TCTCAGCTGCACCTCTCAGCTGG - Intronic
1075776602 10:124993143-124993165 CCTCAGCTCCACAGTGCAGCCGG - Intronic
1076842965 10:133055647-133055669 TCTCAGCTCCACATTCCTGCAGG - Intergenic
1081041443 11:38219559-38219581 TCTCAACTCCACCCCACTGTAGG - Intergenic
1081724755 11:45320555-45320577 TCACAGCGCCACCCCACTGCAGG - Intergenic
1083812968 11:65115924-65115946 CCTCTACTTCACCGCGCTGCTGG + Exonic
1088400334 11:109416502-109416524 CCTCAGCCCCACCACGTTGCTGG - Intergenic
1089807142 11:121100743-121100765 TCTCTGATGCACCGCTCTGCAGG - Intergenic
1089911170 11:122102039-122102061 TCGCCGCTCCCCCGCCCTGCCGG + Intergenic
1090457912 11:126865911-126865933 TCTCACCTCCACCGAGTTTCCGG + Intronic
1091206573 11:133825333-133825355 TCCCAGGTCCACCGCGGTGGGGG - Intergenic
1098595595 12:72271415-72271437 CCTTAGCCCCACCGCGCTCCAGG - Intronic
1103722126 12:122980729-122980751 TCCCACCTCGACCGCCCTGCGGG - Exonic
1103727404 12:123004960-123004982 TGGCCCCTCCACCGCGCTGCAGG + Intronic
1104036983 12:125104469-125104491 TCACAGCTCAACCTCCCTGCAGG - Intronic
1104424032 12:128659954-128659976 TCTCAGCTCCACCGCGCTGCTGG + Intronic
1107929884 13:45298536-45298558 TCTCACCTCCCCCCTGCTGCAGG + Intergenic
1109512983 13:63404068-63404090 TCACAGCTCCACCATGCTGGAGG + Intergenic
1112426101 13:99302713-99302735 TCACAGCTCCACAGCAGTGCAGG - Intronic
1119520568 14:75281394-75281416 GCTCAGCTCACCCACGCTGCTGG + Exonic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1124112421 15:26804405-26804427 CCTCAGCTCAACCAGGCTGCCGG + Intronic
1124167058 15:27337546-27337568 TCTCAAGGCCACCGTGCTGCTGG + Intronic
1125541437 15:40471912-40471934 TCTCAGCCCCATAGCGTTGCTGG - Exonic
1132825958 16:1905734-1905756 TCTGAGCCCCACTGCGCTGCTGG - Intergenic
1137909376 16:52360921-52360943 TCCCACCTCCACAGCTCTGCTGG - Intergenic
1140464186 16:75166346-75166368 TCTCAGCTCCCCCACGTAGCTGG + Intronic
1142499049 17:322171-322193 TCTCTGCTCCACTGGGCTGCGGG + Intronic
1142625744 17:1190802-1190824 CCTCTGCCCCACGGCGCTGCAGG + Intronic
1142639287 17:1276329-1276351 TCTCAGCGCCACCTCGTGGCAGG - Intergenic
1143012483 17:3873516-3873538 ACCCAGCTCCAGCGGGCTGCAGG + Intronic
1143527144 17:7479373-7479395 TCTCCGCTGCCCGGCGCTGCGGG - Intronic
1143830398 17:9645986-9646008 TCTCAGCAACACCGACCTGCTGG + Exonic
1146681997 17:34815183-34815205 TCTCAGCTCCTCCAGGGTGCAGG - Intergenic
1148853242 17:50564939-50564961 GCTCTGCTCCACCGCTCTGCTGG + Intronic
1152614547 17:81331726-81331748 TCTCCGCTCCTCCCAGCTGCAGG + Intergenic
1155993732 18:32307636-32307658 TCTCAGCCCCACCGAGTAGCTGG + Intronic
1157246021 18:46056096-46056118 CCACAGCTCCACAGCCCTGCAGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160856818 19:1221508-1221530 CCTCAGCTCCACCCTGCTTCTGG + Intronic
1161647217 19:5460839-5460861 CCACAGCTGCACCGTGCTGCTGG - Intergenic
1161816377 19:6502206-6502228 CCTCAGCGCCACCGCCATGCGGG - Exonic
1162625203 19:11879699-11879721 TCTCTGCTCCCCCGGGCTCCAGG + Intronic
1164538574 19:29105525-29105547 ACACAGCTCCACGGTGCTGCAGG + Intergenic
1166563371 19:43747967-43747989 TCTCTGCTCACCCGCTCTGCTGG + Exonic
926169079 2:10539731-10539753 TCCCAGCTCCACCGGGACGCAGG + Intergenic
926353461 2:12018545-12018567 TCTCAGCTCTGCTGCCCTGCAGG + Intergenic
930190675 2:48455897-48455919 CCTCAGCTCCCCCGAGCAGCTGG - Intronic
934156490 2:89205783-89205805 TCTCAGCTCCCCTGCAGTGCTGG + Intergenic
934210827 2:89976976-89976998 TCTCAGCTCCCCTGCAGTGCTGG - Intergenic
935593385 2:104861819-104861841 TCTCAGCTCCTCAGGGCTGCTGG + Intergenic
937332417 2:121039903-121039925 TCTCAGCCACACTGTGCTGCAGG - Intergenic
937439494 2:121904086-121904108 TCCCAGCTCCACCATCCTGCTGG - Intergenic
937439742 2:121905701-121905723 TCCCAGCTCCACCATCCTGCTGG - Intergenic
941709238 2:168694336-168694358 TCTCAGCTCTACAGCTCAGCAGG - Intronic
946774649 2:223124940-223124962 TCTCAGCTCCTTCGCTCTGGTGG - Intronic
948678172 2:239611336-239611358 TGTCAGCTCCACTGCGCTTGTGG - Intergenic
948733777 2:239984814-239984836 TCTCAGCCCCCCGGCTCTGCTGG - Intronic
948947103 2:241226300-241226322 TCTCAGCCCCTCCTGGCTGCTGG + Intergenic
1169057754 20:2637467-2637489 TCTCAACTTCACGGAGCTGCAGG - Exonic
1175227845 20:57455280-57455302 TCTCAGCTCACCAGGGCTGCTGG + Intergenic
1179923488 21:44520291-44520313 TCCCAGCCCCACTGCCCTGCAGG + Intronic
1181965174 22:26651414-26651436 TCCCAGCTCCACTTCTCTGCCGG - Intergenic
1182551851 22:31104945-31104967 TCCCAGCTCCGCCGCGCCCCCGG + Exonic
949947951 3:9204848-9204870 TTTCAGCGTCACCGCTCTGCTGG - Intronic
955229368 3:57085326-57085348 TCTCAGTTCCACAGGGCAGCTGG - Intergenic
965133088 3:164726295-164726317 TCTCAACCCCACAGCTCTGCAGG + Intergenic
966615480 3:181908569-181908591 CCTCAGCTCCACCGAGTAGCTGG + Intergenic
980831608 4:138135782-138135804 ACTCAGCTCTACCACACTGCTGG + Intergenic
981713584 4:147732116-147732138 TGGCAGCTCCTCCGCGCCGCAGG + Exonic
982862317 4:160468433-160468455 TCACAGTTCCACCTCGCTGAGGG + Intergenic
986385143 5:7226067-7226089 TCTCAGCTCCACTTTGCTTCTGG + Intergenic
986880289 5:12161604-12161626 TCTCACCTCCACAGCTCTGCAGG - Intergenic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
999326620 5:150648191-150648213 CCTGAGTTCCACCTCGCTGCCGG + Exonic
1003396153 6:5753833-5753855 TCTCAGCACCACCATGGTGCTGG - Intronic
1006393631 6:33773191-33773213 TCTAAGCTCCACAGCACTCCAGG + Intronic
1023101839 7:36725990-36726012 TATCCGCTCCAATGCGCTGCTGG + Intergenic
1029302779 7:99598277-99598299 TCCAGGCTCCACCGCGCTCCTGG - Intronic
1032574887 7:133042980-133043002 CCTCAGCCCCACCGAGCAGCTGG + Intronic
1033304625 7:140215380-140215402 TCACAGCACCACCTCGCTCCAGG - Intergenic
1034912830 7:155011604-155011626 TCCCAGCTCCACCGCACGTCGGG - Intergenic
1035678923 8:1473391-1473413 TCTCAGATCCACTGCGGGGCTGG + Intergenic
1037483404 8:19325935-19325957 TCCCAGCTCCACAGAGCGGCAGG - Intronic
1038017810 8:23529639-23529661 TCTCAGCTCCAGCGTGGTGAGGG - Intronic
1044560587 8:93608092-93608114 TCTAAGCTCCACACAGCTGCTGG - Intergenic
1048926097 8:139272792-139272814 TCTCAGCTCCAGCAGGCTACTGG + Intergenic
1051621029 9:19049539-19049561 GCTCCGCTCCGCCGCGCAGCTGG - Exonic
1052824989 9:33167692-33167714 TCTCTCCGCCGCCGCGCTGCAGG - Intergenic
1056817295 9:89811340-89811362 GCTCAGCTCCTCCTCACTGCTGG - Intergenic
1057390904 9:94640666-94640688 TTTCAGCTCCACCGGTCTCCTGG - Intergenic
1057495524 9:95557650-95557672 GCTCAGCTCCACAGCACTCCAGG - Intergenic
1061149682 9:128821623-128821645 TCTCAGCCCCAGCCCTCTGCAGG - Exonic
1061280661 9:129596399-129596421 TCCCAGCTCCCCAGGGCTGCTGG - Intergenic
1061282051 9:129603013-129603035 TATCAGCTCCTCCCCGCTGCTGG + Intergenic
1061291823 9:129654858-129654880 ACACAGCTCCACCGCACCGCAGG + Intergenic
1061944429 9:133900912-133900934 TCTCAGCTCCCCCGAGAAGCTGG + Intronic
1062209609 9:135356576-135356598 TCTTCCCTCCACCCCGCTGCTGG - Intergenic
1062383737 9:136299978-136300000 GCTCAGCTCCCCTGCCCTGCAGG + Intronic
1062399375 9:136365758-136365780 TCTCAGCCCCACTGCGGTGAGGG + Intronic
1185454727 X:303181-303203 CCTCAGCCCCACGGCTCTGCAGG + Exonic
1187257413 X:17655557-17655579 TCCCAGCTCCACCGGGCTAAAGG - Intronic
1198342882 X:135732287-135732309 TCTCAGCTGCCCTGCACTGCCGG + Intergenic
1198345107 X:135751008-135751030 TCTCAGCTGCCCTGCACTGCCGG - Intergenic