ID: 1104426007

View in Genome Browser
Species Human (GRCh38)
Location 12:128678617-128678639
Sequence CTAGACCAGTGGTTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104425997_1104426007 12 Left 1104425997 12:128678582-128678604 CCTTTGTGTCAACTCTTCCTCCT 0: 1
1: 0
2: 5
3: 44
4: 420
Right 1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG 0: 1
1: 1
2: 6
3: 51
4: 326
1104426000_1104426007 -8 Left 1104426000 12:128678602-128678624 CCTACCCAGGCAGCCCTAGACCA 0: 1
1: 0
2: 0
3: 22
4: 228
Right 1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG 0: 1
1: 1
2: 6
3: 51
4: 326
1104425999_1104426007 -5 Left 1104425999 12:128678599-128678621 CCTCCTACCCAGGCAGCCCTAGA 0: 1
1: 0
2: 1
3: 24
4: 238
Right 1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG 0: 1
1: 1
2: 6
3: 51
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104426007 Original CRISPR CTAGACCAGTGGTTCTCTGT GGG Intronic
901484300 1:9547763-9547785 CTAAACCAGTAGTTCTCAATTGG - Intronic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
903443530 1:23406047-23406069 CTAGACCAGTGGATCTCAGCAGG - Intronic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
905014784 1:34770277-34770299 CTAGACCACAGGCTCTCTGAGGG + Intronic
905111255 1:35596088-35596110 CTAGAACATTTGTACTCTGTGGG - Intergenic
905223992 1:36467496-36467518 CTGGACCTGAGGTTCCCTGTGGG + Intronic
906369341 1:45239358-45239380 TCAGAACAGTGGTTCTCTCTGGG + Intronic
907529180 1:55076113-55076135 CTAGATCTATAGTTCTCTGTGGG + Intronic
907725648 1:57017880-57017902 ATGGCCCAGTGGTTCTCAGTGGG + Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
908456314 1:64308211-64308233 CTATCCCAGTGGTTCTCAATCGG + Intergenic
908523931 1:64969500-64969522 CTAGACTAGTGGTTCTCAGTGGG - Intergenic
911308754 1:96266456-96266478 ATAGATCAGTGGTTGTCTGAGGG + Intergenic
913132074 1:115849190-115849212 GTAGAACAGTGGTTTCCTGTGGG - Intergenic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
913402881 1:118455402-118455424 CTAGACCTCTGATTCTCTGATGG + Intergenic
915135844 1:153730881-153730903 CTAGACCAGAGGGTCTCTAAGGG + Intronic
915956000 1:160220483-160220505 CTGGCCCAGAAGTTCTCTGTCGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
917942180 1:179933412-179933434 TTACACCAGTGGTTTTCTGGTGG - Intergenic
918215286 1:182388229-182388251 TTAGAGCAGTGGTTTTCTGAGGG + Intronic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
919899233 1:202031776-202031798 CTAAATTGGTGGTTCTCTGTAGG + Intergenic
920333159 1:205226903-205226925 CTAGGCCAGTGGTTCTCAAAGGG + Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
923146692 1:231203531-231203553 CAAAACCAGTGGTTCTCAGTGGG + Intronic
923386490 1:233470415-233470437 CGATACCAGTGGTTGTCTCTGGG + Intergenic
924234158 1:241986788-241986810 CTAGACCAGTGGTTCTCAGCCGG + Intergenic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
1062895886 10:1102852-1102874 CTAGAACAGAAGTTCTCTGAGGG + Intronic
1063498452 10:6531309-6531331 CTAAATCAGTGGTTCTCAGAGGG + Intronic
1067847113 10:49733229-49733251 CCAGACTAGTGGATTTCTGTGGG + Intergenic
1068837695 10:61572110-61572132 CTACACCAGTGGTGTTCTGGGGG + Intergenic
1069283443 10:66684120-66684142 CTAAACCAGCAGTTCTCAGTTGG + Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1070416718 10:76197431-76197453 CTAAACCAGTGGTTCTCAAGTGG + Intronic
1070528506 10:77315890-77315912 CTAGACTGTGGGTTCTCTGTGGG + Intronic
1071033092 10:81207507-81207529 CTACACCAGTGGTTTGCTGGTGG + Intergenic
1071478403 10:86044088-86044110 CTTGAGCAGTGTTTCTGTGTGGG - Intronic
1071597403 10:86938345-86938367 CTAGACTTCTGGTTCTCTGCAGG + Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1072256444 10:93625880-93625902 GTAGACCAGTGGTTCTCAACTGG + Intronic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1072565844 10:96616008-96616030 CTATGCCAGAGGCTCTCTGTGGG + Intronic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1073006000 10:100325272-100325294 CTAGACCATAGGTTCTCAGTGGG - Intronic
1073302239 10:102477938-102477960 CTAGAGCAGTGGTTCCCAATTGG - Intergenic
1074119340 10:110481799-110481821 CTAGACCAGTGGTCCTCACAGGG - Intergenic
1074563951 10:114559610-114559632 CTCTACCAGTGCTTCCCTGTGGG + Intronic
1074984244 10:118643107-118643129 CCACTCCAGGGGTTCTCTGTTGG + Intergenic
1076529689 10:131136115-131136137 CTAGACCAGTGGCTCTCAACTGG - Intronic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1078145625 11:8720159-8720181 CTAAAGCAGTGGTTCTCAGTTGG - Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1079419344 11:20271434-20271456 CTAGGCTAGTGGTTCTCAATGGG + Intergenic
1079435733 11:20447228-20447250 CTAGAACAGTGGTTTTCAATGGG + Intronic
1080515858 11:33019336-33019358 TTAACCCAGTGGTTCTCAGTGGG - Intronic
1081535597 11:43993779-43993801 CTGGTCCAGTGGTCCTCAGTGGG + Intergenic
1083380203 11:62261291-62261313 CTAGAGCAGTGGGTCACAGTGGG - Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1086473129 11:87138874-87138896 CTAGAGCAGTGGTTCTTAATTGG + Intronic
1089292656 11:117447458-117447480 ATATACCAGTGTTTATCTGTAGG + Intronic
1090027067 11:123176986-123177008 CTAGACCATAAGCTCTCTGTAGG - Intronic
1091610301 12:2001917-2001939 TTAGACCAGTGGCTCTCAGCTGG - Intronic
1092778794 12:11966478-11966500 CTGGAACAGTGGTTCTTGGTTGG - Intergenic
1093445296 12:19250123-19250145 CTAGACAAGTGGTTCTCAATTGG - Intronic
1093670734 12:21871842-21871864 ATAGACCAGTGGTTCTCAAACGG - Intronic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1096890544 12:54766451-54766473 CTAGACCAATGGTTCTCAACTGG + Intergenic
1100668517 12:96783404-96783426 TTAGAACAGTGGTTGTCTCTGGG - Intronic
1100675412 12:96861253-96861275 TTAAACCAGTGGTTCTCAATTGG + Intronic
1100726981 12:97419062-97419084 CTATACCAGTGGTTCTCAAGAGG + Intergenic
1101339926 12:103834173-103834195 CTGGAGCAGTGGTTCTCAGTGGG - Intronic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102654704 12:114472042-114472064 CTAAAACAGTGATTCTCAGTGGG - Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1106383267 13:29260758-29260780 CTAGAGCAGTGGTTCTTAATCGG + Intronic
1107650562 13:42540799-42540821 CTAGACCAGTGGTTCCCAACTGG - Intergenic
1110777727 13:79429475-79429497 TTAGAACAGTGGTTGTCTATGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1114534668 14:23415331-23415353 CCAGACCAGTGTCTCTCCGTGGG - Intronic
1116971338 14:51069291-51069313 CTAGACCACTGGTTCTCATCTGG + Intronic
1120374727 14:83688873-83688895 CTAGAACAGTGGTTCTAGATTGG + Intergenic
1121702275 14:95963603-95963625 CCACACCAGTGGTTCTCTTGAGG + Intergenic
1122042526 14:98999115-98999137 CTAGAGCAGTGATTCTCTCCAGG - Intergenic
1124175090 15:27417030-27417052 CTAGAGCAGTGGTTCTTAGCTGG + Intronic
1127369823 15:58329387-58329409 GTAGAACTGTGGTTCTCTGAGGG + Intronic
1128397531 15:67243432-67243454 CTAAAGCAGTGGTTCTCTATGGG + Intronic
1128728441 15:70004951-70004973 CTGGACCAGGGGTTTGCTGTGGG - Intergenic
1128766944 15:70256999-70257021 CTAGACCAGCGGTTCTCAACTGG - Intergenic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1130366957 15:83249384-83249406 CTAGACCAGTGATTCTCAACTGG + Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1131019014 15:89082150-89082172 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1131102235 15:89701828-89701850 TTAGGCCAGTCCTTCTCTGTTGG - Exonic
1131123616 15:89839128-89839150 CTGGACCAGTGGTTCTCAGCTGG - Intronic
1131701264 15:94938632-94938654 TTACACCAGTGGTTCTCCATGGG - Intergenic
1133474817 16:6110706-6110728 CCAGAGCAGTGGTTCTCAATGGG + Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1134372791 16:13641112-13641134 CTAGACCAATGGTTCTCAACTGG + Intergenic
1134380187 16:13717097-13717119 CTAAACCAGTGGTTCTCAACTGG + Intergenic
1134559975 16:15200199-15200221 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1134864312 16:17591082-17591104 CTAGAGCAGTGGCTCTCCTTAGG + Intergenic
1134920515 16:18111808-18111830 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1135029305 16:19025234-19025256 CTAGAGCAGTGGTTCTCATCTGG - Intronic
1135078643 16:19415333-19415355 TTAGAGCAGTGGTTCTCAGGGGG + Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135210490 16:20521785-20521807 CTAGACCAGTGGGTCTCACCTGG - Intergenic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135422388 16:22313934-22313956 CTAAGCCAGTGGTTCTCAATCGG - Intronic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135670742 16:24373539-24373561 CTGTACCAGTGGTTCTCAGTTGG - Intergenic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1135959533 16:26984268-26984290 CTACACCAGTGGTTTGCTGGAGG - Intergenic
1137306437 16:47205373-47205395 TTGGACCAGTGGTTCTCAATCGG - Intronic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138197178 16:55060330-55060352 CTAGCCCAGTGGTTCTCAACAGG + Intergenic
1139557324 16:67720517-67720539 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1139718776 16:68836155-68836177 ACAGGCCAGTGGTTCTCTGCTGG + Intergenic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140251889 16:73301586-73301608 CTAGGCCAGTGGTTCTCAACTGG - Intergenic
1140508012 16:75486528-75486550 CTAGGCCAATAGTTCTGTGTGGG - Intronic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1142545573 17:699909-699931 CTAGGACAGTGGTTATCTCTGGG + Intronic
1145103755 17:20097998-20098020 CTAGAACAATGGTTCTCAATGGG - Intronic
1146256953 17:31397217-31397239 CCAGATCAGTGGTTCCCTGTAGG + Intronic
1147505704 17:41015154-41015176 ATATACCAGTGGTTCTCCATGGG - Intronic
1148205590 17:45777788-45777810 CCAGACCAGTGGCTCTCTCCCGG - Intergenic
1148857134 17:50584903-50584925 CTGGACAAGTGATTCCCTGTGGG - Intronic
1149051636 17:52311752-52311774 TTATACCAGTGGTTCCCAGTTGG - Intergenic
1149056376 17:52371366-52371388 TTATACCAGTGGTTCTCAATTGG - Intergenic
1149297122 17:55271097-55271119 CTAGACCAGTGGTTCTCCACCGG - Intronic
1149437012 17:56641693-56641715 TTAGACCACTTGTTCTCTGGGGG - Intergenic
1149689804 17:58565884-58565906 CTAGAGCAGTGGTTCTCCAAGGG + Intronic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151401229 17:73857319-73857341 CTATAGCAGTGGTTCTCCCTGGG + Intergenic
1152140345 17:78532811-78532833 CTTGAGAAGTGGTTCTCTGTTGG + Intronic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1154463548 18:14620403-14620425 GTAGGCCAGTGGTTCTCTGGGGG - Intergenic
1156858890 18:41813962-41813984 CTAGGCCAGTGGGTCTGTGATGG + Intergenic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1157897749 18:51484823-51484845 CTAGAGCAATAGTTGTCTGTTGG + Intergenic
1158283570 18:55853557-55853579 CTAAAACAGTGCTTCTCAGTTGG - Intergenic
1158463187 18:57665117-57665139 CTAGTGCAGTGATTCTCCGTGGG - Intronic
1159103371 18:63979433-63979455 CTAGACTAGTGGTTCTCACCTGG + Intronic
1159618966 18:70615428-70615450 GTATACCAGTTGTTTTCTGTTGG + Intergenic
1161850672 19:6736648-6736670 CTACACCAATGGCTCTCTGGAGG - Exonic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1164807056 19:31125167-31125189 CTAATCGAGTGGTTCTCTCTTGG - Intergenic
1165874823 19:38998839-38998861 CTAAAGCAGTGGTTTTCAGTTGG + Intronic
1166609953 19:44182454-44182476 CTATAACACTGGTTCTCAGTTGG - Intergenic
1168318112 19:55493090-55493112 CTAGACTAGTGGCTCTCAGCTGG + Intronic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
929143760 2:38688565-38688587 CTAAACTAGTGGTTCTCAATTGG - Intronic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
931112068 2:59122052-59122074 CTAGGCCAGTGGTTCTCAACTGG + Intergenic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
932189572 2:69729435-69729457 ATAGAGCAGTGGTTCTCAATGGG + Intronic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
933893857 2:86793014-86793036 CTGTAACAGTGGTTTTCTGTGGG - Intronic
936463832 2:112729751-112729773 CTAGAGTAGTGGTTCCCAGTGGG + Intronic
936614931 2:114038947-114038969 ATAGACTAGTGGTTCTCAATCGG + Intergenic
938645677 2:133327820-133327842 ATAGACCAGTGCTTCTCAGTGGG + Intronic
938970137 2:136424282-136424304 CTAGGACAGTGGTTTCCTGTAGG + Intergenic
939137019 2:138308856-138308878 GTAGGACAGTGGTTCTCAGTTGG - Intergenic
939214844 2:139222792-139222814 CTAGAGCAGTGCTTCTGTATGGG + Intergenic
939329898 2:140744019-140744041 CTAAAACAGTGGTTATCAGTGGG + Intronic
939730470 2:145778288-145778310 CTACAATAGTGGTTATCTGTAGG + Intergenic
940005604 2:149006996-149007018 TTAGACCAGTGTTTTTCTGCCGG + Intronic
941264574 2:163344537-163344559 CCAAAGCAGTGGTTCTCTGGTGG - Intergenic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
942839479 2:180341770-180341792 TTACACCAGTGGATCTCTGGGGG + Intergenic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
943289121 2:186045821-186045843 CTCAACTATTGGTTCTCTGTAGG + Intergenic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945307775 2:208275240-208275262 CTAGACCAGATTTTCTCTCTGGG + Intronic
947831201 2:233143014-233143036 CTAGCCCAGTGGTCCTCAGCTGG - Intronic
1170333073 20:15236933-15236955 CTAAACCAGTGGTTCTCAGTGGG + Intronic
1170816160 20:19716189-19716211 TTAGAGCAGTGGTTCTCAGAGGG - Intronic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172829581 20:37821951-37821973 CTATGACAGTGGTTCTCAGTTGG - Intronic
1173190679 20:40873332-40873354 TTACACCAGTGGTTCTCAATTGG - Intergenic
1174103258 20:48143399-48143421 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1174186901 20:48712519-48712541 CTCCTCCAGTGGTTCCCTGTGGG + Intronic
1174497052 20:50954248-50954270 CTATACCAATGGTTCTCTACTGG + Intronic
1174640568 20:52040431-52040453 CTAGCCCAGCGGTTCTAAGTGGG + Intergenic
1174668895 20:52287113-52287135 CTATAGCAGTGGTTCTCAATGGG - Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1175197252 20:57252830-57252852 CTAAACCAGTGGTTCTCAACTGG + Intronic
1175618344 20:60422514-60422536 CTGGCCTGGTGGTTCTCTGTGGG - Intergenic
1176672471 21:9747272-9747294 CTAGGCCAGTGGTTCTCCAACGG - Intergenic
1176810976 21:13537969-13537991 GTAGGCCAGTGGTTCTCTGGGGG + Intergenic
1176924379 21:14729735-14729757 CTAGGCTAGTGGTTCTATATTGG - Intergenic
1177936723 21:27357351-27357373 CTAGACCATTGGCTCTGTGAAGG - Intergenic
1178905851 21:36635429-36635451 CTAAACCAGTGGTTCTTAGCCGG + Intergenic
1178924189 21:36761513-36761535 CTAGAACGGGGGTTCTCAGTGGG + Intronic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1179265622 21:39800001-39800023 CTAGACAAGAGTTTCCCTGTTGG + Intronic
1179972294 21:44842866-44842888 CAAGGCTAGTGGGTCTCTGTGGG - Intergenic
1180618135 22:17141893-17141915 CCAGACCAGTGATTCTCCATGGG + Intronic
1181849060 22:25736751-25736773 CTAAACCAGTGGTTCTCAAATGG - Intergenic
1181980276 22:26761238-26761260 CCAGACCACTGGGTGTCTGTGGG + Intergenic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182815377 22:33157545-33157567 AATGAGCAGTGGTTCTCTGTTGG - Intergenic
1183040384 22:35173399-35173421 CCAGGACAGTGGTTCTCAGTTGG - Intergenic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
1184884062 22:47331472-47331494 CCAGACCTGAGGGTCTCTGTGGG - Intergenic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
949582825 3:5407915-5407937 ATAGACCAGCAGTTCTCTGCTGG - Intergenic
949908504 3:8879708-8879730 CTAGAACAATGGTTCCCAGTGGG - Exonic
950272674 3:11631178-11631200 CCAAAACAGTGGTTCTCTTTGGG + Intronic
950671949 3:14532592-14532614 ATAGAGCAATGGTTCTCTGTTGG - Intronic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
953103287 3:39851364-39851386 CTAAACCAGTGATTCTCAGCAGG - Intronic
953156856 3:40383481-40383503 TTAGACCAGTGGTTCTCACCAGG + Intergenic
953620732 3:44530509-44530531 CAAGAGGAGTGATTCTCTGTTGG + Intergenic
953843824 3:46410944-46410966 CTGGAACAGTGGTTCTCAGAAGG - Intronic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
958729655 3:97948280-97948302 CTATCTCAGTGGTTCTCTCTTGG + Intronic
959475592 3:106808104-106808126 CTCCATCATTGGTTCTCTGTTGG - Intergenic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
962896412 3:139718823-139718845 CTAAGGCTGTGGTTCTCTGTGGG - Intergenic
963819436 3:149871745-149871767 ATATACCAGTGGTTGTCTTTGGG + Intronic
964504837 3:157387870-157387892 ATAGACCAGTGATTCTCCTTTGG - Intronic
965167824 3:165219086-165219108 CTATACCAGTGGTTCTCAGTTGG - Intergenic
965197457 3:165620214-165620236 ATAGGACAGTGGTTCTCAGTTGG + Intergenic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
968241202 3:197087890-197087912 CTAAACCACTGGTCTTCTGTGGG - Intronic
970433792 4:16013636-16013658 CTATACCAGTGGTTCTCAACTGG + Intronic
970919909 4:21381884-21381906 CTAGACCATTGGTGATATGTGGG - Intronic
972685276 4:41346371-41346393 CTGGTCCATTGTTTCTCTGTGGG + Intergenic
973843126 4:54882818-54882840 TTAGAACAGTGGTTGCCTGTAGG - Intergenic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
975288197 4:72645270-72645292 ATAGACCAGTGGTTCTCATCTGG - Intergenic
975601825 4:76108617-76108639 ACAGACCAGTGGTTCTCAGGGGG - Intronic
976778857 4:88736703-88736725 ATAGATCAGTGTGTCTCTGTGGG - Intronic
977065036 4:92304171-92304193 GAAGACCAGTGATTCTCTGCGGG + Exonic
977302331 4:95282009-95282031 CTAGACCTGTGGTTCTCAACTGG - Intronic
977697992 4:99988578-99988600 ATAGACCAGTGCTTCTCAGCTGG - Intergenic
980070128 4:128235012-128235034 CTAGACCAGTGGTTGTCAGGTGG + Intergenic
980937782 4:139242610-139242632 CTTGACCTGTGGTTTTCTCTGGG + Intergenic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
982652748 4:158107971-158107993 CTAACCCAGTGGTTCTCAGTTGG + Intergenic
983384316 4:167038604-167038626 TTAGACCACAGGTTCTCTATAGG - Intronic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
984789387 4:183600986-183601008 CTAGACCAGTAGTTCCTTGTTGG - Intergenic
985402259 4:189604559-189604581 CTAGGCCAGTGGTTCTCCAACGG + Intergenic
986548136 5:8922395-8922417 CCAGAGCAGTGGTTCTCAGCTGG + Intergenic
986825605 5:11518805-11518827 CTAGACCACTAGGTCTGTGTAGG + Intronic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
991380138 5:66012955-66012977 CTAAACCAGTGGTTCTCAACTGG + Intronic
991463130 5:66880307-66880329 TTAGAACAGTGGTTCTCTCTGGG + Intronic
991628600 5:68631159-68631181 CTATAGAAGTGTTTCTCTGTGGG + Intergenic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
992794444 5:80243103-80243125 AAAGACCAGGGGTTCTCTCTAGG - Intronic
993873569 5:93280084-93280106 CTAGAGCAGTTGTTCATTGTAGG + Intergenic
994326939 5:98459099-98459121 CCATACCAGTGGTTTTCTGGTGG - Intergenic
994554186 5:101276854-101276876 CTATACCAGTGGTTATTTCTAGG + Intergenic
994561610 5:101381066-101381088 CTAGACCCGTGCTTTACTGTAGG - Intergenic
994848161 5:105017333-105017355 CTAAATCAGTGGTTCTAAGTTGG - Intergenic
994851714 5:105063314-105063336 CTAGGCCAGTGCTTCTCTGAGGG - Intergenic
998467255 5:142356272-142356294 CTAGAACAGCGGCTTTCTGTAGG - Intergenic
998553128 5:143096854-143096876 TTAGGACAGTGGTTCTCTGTTGG - Intronic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999417410 5:151410972-151410994 TTAGACCAGTGGTTCTTAATTGG - Intergenic
1000253276 5:159514896-159514918 CTAGGGCAGTGGTTCTGAGTTGG + Intergenic
1000563071 5:162814402-162814424 CTAGAACAGTGGTTCCCAGCTGG - Intergenic
1001019594 5:168172026-168172048 CCAGACCAGTGGTTCCCTACCGG + Intronic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1002676868 5:180923994-180924016 CTTGACCAGTGGGGCTCAGTAGG - Intronic
1004678051 6:17863555-17863577 CTATACCAGTGGTGCCCTGAAGG - Intronic
1004777662 6:18866122-18866144 CTAGACCAATGGTTCTCATGTGG - Intergenic
1004927407 6:20428946-20428968 GTAGACCAGTGGTTCTCAACTGG + Intronic
1005387524 6:25300043-25300065 CTAAACCAATGATTCTCAGTGGG - Intronic
1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG + Intronic
1007226354 6:40318026-40318048 CCAGACTAGTGGTTATCTCTGGG + Intergenic
1007310296 6:40940046-40940068 CAAGATGAGTGGTTCTCAGTTGG + Intergenic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009268166 6:61582969-61582991 CTATTCCAGTGTTTTTCTGTGGG - Intergenic
1010316175 6:74453306-74453328 TTATAACAGTGCTTCTCTGTGGG + Intergenic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1011184085 6:84654976-84654998 CTAGAGAAGTGGTTCTCAGAGGG + Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1014000609 6:116362045-116362067 CTGCACCAGTGGTTCTCAGATGG + Intronic
1014452201 6:121594366-121594388 CTAAACCAGAGGTTCTCCATCGG - Intergenic
1014491168 6:122063933-122063955 CTAGACCAGTGCTTCTCAATAGG + Intergenic
1015160467 6:130147358-130147380 CTAGATTAGTGGTCCACTGTGGG - Intronic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1017777486 6:157691456-157691478 CTAGACCAGAAGCTCTCTCTGGG + Intergenic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018165570 6:161090953-161090975 CTAGTCCAGGGGTTCTCTTCTGG - Intronic
1018249521 6:161854786-161854808 CTAGAAAAGTGGTTCTCGGCCGG + Intronic
1018431808 6:163728820-163728842 CTAGCCCAGTGGTTCTCAACTGG + Intergenic
1018652684 6:166005310-166005332 CCAGACCAGTGGTTTTCTCACGG - Intergenic
1018729595 6:166638677-166638699 CTAGAACAGTGGTTCTGGGGCGG + Intronic
1018729886 6:166640780-166640802 CTAGACCAGAGGTTCAGTGGGGG + Intronic
1018771003 6:166971419-166971441 CTGGACCAGTGGTTCCCGATTGG - Intergenic
1018847486 6:167565677-167565699 CTAGCACAGTGCATCTCTGTTGG - Intergenic
1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG + Intergenic
1021982833 7:26071389-26071411 CCAGACCAGTAGTTATCAGTGGG + Intergenic
1022769959 7:33459268-33459290 CTAGAGCTGTGGTTCTCAATTGG + Intronic
1023082423 7:36537886-36537908 CTAGGCCAGTGGTTCTCAACTGG - Intronic
1023270598 7:38457601-38457623 CTAGCCCATTTGTTCTCTCTTGG - Intronic
1026838319 7:73652913-73652935 TTAGACCAGAGGTCCTCTGAGGG - Intergenic
1027528514 7:79301099-79301121 CCATAGCAGAGGTTCTCTGTGGG - Intronic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1030045417 7:105490794-105490816 CTAGACCAGTGGTTCCCAATCGG + Intronic
1030337953 7:108345883-108345905 CTAGAACAATGGGTGTCTGTGGG + Intronic
1031192099 7:118565833-118565855 CTATATCAGTGGTTCTCCATTGG - Intergenic
1031631709 7:124050930-124050952 AAAGATCAGTGGTTCTCTTTGGG + Intergenic
1032022343 7:128415545-128415567 CTAAGCCAGTAGTTCTCTGTGGG + Intergenic
1033363124 7:140651944-140651966 CTAAACCAGTGTGTCTCTGGTGG - Intronic
1033805870 7:144953641-144953663 CTAGACCTCTGGGCCTCTGTTGG + Intergenic
1035014420 7:155752663-155752685 TTAGACCAGTGGTTCTCACAGGG - Intronic
1035469010 7:159097974-159097996 CTGGCCCAGTGGGTCTGTGTGGG - Intronic
1036096784 8:5733480-5733502 CCATACCAGTGTTTCTCAGTGGG + Intergenic
1036920103 8:12844237-12844259 CTAGAGCAGTGGTTCTCAGAGGG - Intergenic
1036957697 8:13207656-13207678 TTAGAGTAGTGGTTCTCAGTTGG + Intronic
1037340463 8:17839173-17839195 CTAGAACAGTGGTTCTTGGCCGG - Intergenic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037573824 8:20181720-20181742 CTACATCAGTGTTTCTCAGTGGG - Intronic
1038393841 8:27232002-27232024 CTACACCAGTGGCTTTCAGTGGG - Intergenic
1038500255 8:28037792-28037814 CTAGACCAGTGATTCTCAACCGG + Intronic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1044588902 8:93894746-93894768 CCAGAACAGTGGTTCTTTCTGGG + Intronic
1046608864 8:116402254-116402276 CTTGACCAGTGGTTCTCAATTGG - Intergenic
1047191770 8:122684924-122684946 CTAAATCTGTGGTTCTCAGTTGG + Intergenic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1048235720 8:132688272-132688294 CTAGACATCTGGTTCCCTGTGGG + Intronic
1048426234 8:134326439-134326461 CTAATCCAGTGGTTCTCTGCTGG + Intergenic
1050153471 9:2641050-2641072 CTAGACCACTATTTATCTGTTGG - Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1051617064 9:19016493-19016515 CTAGCCCAGTGATTCTCAGGTGG + Intronic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1053376585 9:37612229-37612251 CTTGCACAGTGGCTCTCTGTGGG + Intronic
1054805235 9:69391123-69391145 CCAGACCAGTGGTTCTTACTTGG + Intronic
1054813412 9:69452426-69452448 CTGGGCCAGTGGTTCTACGTGGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1057149808 9:92786243-92786265 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1059496454 9:114713717-114713739 ATAGACCAGTGGTTCTCACCTGG + Intergenic
1060633683 9:125182854-125182876 CTAGACCAGTCGTTCTCAACTGG - Intronic
1060905882 9:127305095-127305117 TTAGGACAGTGGTTCTCTTTTGG + Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1185869950 X:3656446-3656468 GTAGACCGGTGTTGCTCTGTGGG + Intronic
1186019539 X:5238538-5238560 GTAGATCCGTGGATCTCTGTAGG - Intergenic
1186202192 X:7165886-7165908 CTAGACCAGTGGTTCTTGCCAGG - Intergenic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1187261696 X:17690633-17690655 CTAGACCAGGGATTCCTTGTGGG - Intronic
1187317005 X:18205887-18205909 ATAGCCCAGTGGTTCTCACTGGG - Intronic
1187557968 X:20370094-20370116 GCAGACCAGTGGTTCCCTGAGGG - Intergenic
1188260722 X:28019960-28019982 CTAGACCAGTGGTTGTCAACTGG - Intergenic
1188774450 X:34196558-34196580 CTACACCAGTGCTTTTCTATAGG + Intergenic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1192233256 X:69280082-69280104 CTAGACCAGGAGTTCTCCGAGGG + Intergenic
1192490487 X:71572169-71572191 CCAGAACAGTGGTTGTCTCTGGG - Intronic
1193384628 X:80855841-80855863 GGAGACCAGAGATTCTCTGTAGG + Intergenic
1194668261 X:96699377-96699399 TTAGACCAGTGATTTTCAGTGGG + Intronic
1195011618 X:100737747-100737769 CTTGACCAGTGGTTCTCAACTGG - Intergenic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1197319837 X:125014691-125014713 ATAGACCACTGATTCTCAGTTGG + Intergenic
1199083140 X:143598845-143598867 CGAGAGCAGTGGTTGTCAGTAGG + Intergenic
1199811165 X:151351085-151351107 CTAGACCAGAAGTCCTTTGTGGG - Intergenic