ID: 1104427592

View in Genome Browser
Species Human (GRCh38)
Location 12:128690918-128690940
Sequence GAACCATGGATGGCTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104427592_1104427603 0 Left 1104427592 12:128690918-128690940 CCCAGAGTAGCCATCCATGGTTC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1104427603 12:128690941-128690963 CCGGAAGCTGGGGAAAGAGAGGG 0: 1
1: 0
2: 5
3: 46
4: 504
1104427592_1104427598 -10 Left 1104427592 12:128690918-128690940 CCCAGAGTAGCCATCCATGGTTC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1104427598 12:128690931-128690953 TCCATGGTTCCCGGAAGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 184
1104427592_1104427601 -1 Left 1104427592 12:128690918-128690940 CCCAGAGTAGCCATCCATGGTTC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1104427601 12:128690940-128690962 CCCGGAAGCTGGGGAAAGAGAGG 0: 1
1: 0
2: 2
3: 39
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104427592 Original CRISPR GAACCATGGATGGCTACTCT GGG (reversed) Intronic
900356310 1:2266472-2266494 GTACCATGGCTGGGAACTCTCGG + Intronic
900773917 1:4567442-4567464 GCACCATAGTTGGCTCCTCTGGG + Intergenic
902711447 1:18242851-18242873 GAGCCAGGGATGGCATCTCTAGG - Intronic
905457774 1:38100408-38100430 GACCCATGAATGGCTTCCCTAGG + Intergenic
906293420 1:44634593-44634615 GGATCAGAGATGGCTACTCTGGG - Intronic
908460934 1:64347912-64347934 GAACCATGAAAGGCTGCTCTGGG + Intergenic
912045976 1:105458002-105458024 GAACCAAGGATTGCTTTTCTTGG - Intergenic
915850340 1:159314839-159314861 GAAGCATAGAAGGCTACCCTGGG + Intergenic
919326563 1:196114511-196114533 AAACAATAGCTGGCTACTCTGGG + Intergenic
921287645 1:213623285-213623307 GAACCATGGATGGGCACTGTGGG + Intergenic
1063903747 10:10762264-10762286 GAAGAATGGATGTCCACTCTGGG + Intergenic
1068930974 10:62589848-62589870 GAACCATGGACGTCTGCTCTGGG + Intronic
1069309177 10:67011938-67011960 AAACCATGGATGGGTACTCCTGG - Intronic
1071368976 10:84931622-84931644 GAATCATGAATGGCTTATCTTGG + Intergenic
1072047032 10:91667207-91667229 AGACCCTGGATGGCTCCTCTGGG - Intergenic
1072295843 10:94008924-94008946 GAACCATGGATGGGTGCTAGAGG + Intronic
1072682323 10:97516376-97516398 CCACCGTGGATGGCTTCTCTGGG + Intronic
1073096014 10:100980163-100980185 GGACCAGGGATGGCAAGTCTTGG - Exonic
1073763197 10:106652878-106652900 GAGACATAGATGGCTAATCTAGG + Intronic
1081715761 11:45248987-45249009 GAACCATGCAAGACTACCCTTGG + Intronic
1084439463 11:69164307-69164329 GAAACATGGTTGGCCACTGTGGG + Intergenic
1084858671 11:72004488-72004510 GACCCATGGATGGGAACTGTTGG - Intronic
1086987526 11:93266596-93266618 GAATCATGGACAGCTATTCTAGG + Intergenic
1088908021 11:114169483-114169505 GAAACCTCGATGACTACTCTGGG + Intronic
1096944731 12:55392188-55392210 GTGCCATGGATAGCTACTGTAGG - Intergenic
1104427592 12:128690918-128690940 GAACCATGGATGGCTACTCTGGG - Intronic
1105704807 13:22962277-22962299 AAACCGTGGAGGGCCACTCTGGG - Intergenic
1105857769 13:24387435-24387457 AAACCGTGGAGGGCTACTCTGGG - Intergenic
1111751470 13:92336794-92336816 GAACCAGGAATAGATACTCTAGG - Intronic
1116726047 14:48562452-48562474 GAATCATGGACAGCTATTCTAGG + Intergenic
1117193501 14:53316842-53316864 GAGCCAGGGATGGCTTCCCTGGG + Intergenic
1118879628 14:69815330-69815352 GACCCATGGTTGGCCACCCTGGG - Intergenic
1121018927 14:90567072-90567094 GATCCACGGATGCCTGCTCTGGG - Intronic
1121890400 14:97584775-97584797 GAACCCTGGATGGTGACTCCTGG + Intergenic
1126016370 15:44355242-44355264 GACCTATGGATGGCTTTTCTGGG + Intronic
1128127056 15:65200901-65200923 TGACCATGGATGGCTACTTGAGG - Intronic
1130274483 15:82469317-82469339 GGAGCACGGATGGTTACTCTGGG + Intergenic
1130316947 15:82804148-82804170 GAATCATCCATGGCTACTGTGGG + Intronic
1130407372 15:83613847-83613869 GAGGCATTGATGGCTTCTCTTGG + Intronic
1130466830 15:84196691-84196713 GGAGCATGGATGGTTACTCTGGG + Intergenic
1130497434 15:84476845-84476867 GGAGCATGGATGGTTACTCTGGG - Intergenic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1130589125 15:85201284-85201306 GGAGCATGGATGGTTACTCTGGG + Intergenic
1131868603 15:96738355-96738377 GATCCATAGAAGGCTAGTCTGGG + Intergenic
1132973814 16:2701770-2701792 GGCCCATGGCTGGCTACCCTGGG - Intronic
1137032785 16:35539752-35539774 CAACCATTGATGCCTTCTCTAGG + Intergenic
1138434707 16:56990889-56990911 GCATCATGGATGGCCATTCTGGG - Intronic
1138647516 16:58435851-58435873 GAACCCTGGATGGCTGACCTGGG - Intergenic
1142970105 17:3605606-3605628 TAACCATGGATGGAAACCCTTGG + Intergenic
1146607199 17:34270895-34270917 GAGGAATTGATGGCTACTCTGGG - Intronic
1153718501 18:7876523-7876545 GAGCCATGCATGGCTGATCTTGG + Intronic
1154502205 18:15002594-15002616 GCACCATGGATGGCTATGTTGGG - Intergenic
1155345324 18:24851905-24851927 TACCCACGGAGGGCTACTCTGGG - Intergenic
1158889095 18:61856562-61856584 GATCCAAGGATGGCTATTCCTGG + Intronic
1160030884 18:75258755-75258777 CAGTCCTGGATGGCTACTCTAGG - Intronic
1160058553 18:75509213-75509235 TAGCCAGGGATGGCTTCTCTGGG - Intergenic
1164831840 19:31328508-31328530 GAAACATGGATGGCTCAGCTGGG - Intronic
928102506 2:28447434-28447456 GAACCAAGGATGTCTTCTCATGG - Intergenic
932481193 2:72040400-72040422 AAACCTTGGATGGCTCCTCTTGG - Intergenic
938501380 2:131832766-131832788 GCACCATGGATGGCTATGTTGGG - Intergenic
939548531 2:143584055-143584077 AAAACATGAATGGTTACTCTTGG - Intronic
940272146 2:151902896-151902918 GAACCCTGGGTTGCTACTATCGG + Intronic
945493135 2:210478999-210479021 GAACCAAGGAGGGATTCTCTGGG - Intronic
946430543 2:219624924-219624946 GCACAAAGGATGGCCACTCTGGG - Intergenic
1171955772 20:31462326-31462348 CAACAATGGATGGATACTGTAGG - Intergenic
1173557069 20:43973819-43973841 GAACCATGCATGCCTACGCAAGG - Intronic
1175060005 20:56233346-56233368 GCACCATGGTTGGCCACTATAGG + Intergenic
1175483766 20:59329992-59330014 AAACCATCCATGGCTTCTCTTGG - Intergenic
1176253635 20:64139376-64139398 GAAACATGGATGGCCCCCCTGGG - Intergenic
1181052605 22:20244908-20244930 CCACCATGGGTGGCTAGTCTTGG - Intronic
1183125398 22:35775170-35775192 AACCCATGGATGCCTCCTCTGGG - Intronic
1183301613 22:37061611-37061633 AAACCAGGGATGGCAGCTCTGGG - Exonic
1184870814 22:47237396-47237418 GAACCAAGGCTGGATATTCTAGG + Intergenic
953195226 3:40726049-40726071 AAACCATGGAAGGATACCCTAGG + Intergenic
962431456 3:135324259-135324281 GAGCCTTCGATGGCTACTTTGGG - Intergenic
962768602 3:138592031-138592053 GTACCTTGGATGCCTGCTCTGGG - Intronic
963190607 3:142467666-142467688 GAAACATGGATATCTACTCTCGG + Intronic
964682717 3:159360099-159360121 CAACCAGGGAGGGCTCCTCTGGG - Intronic
971477541 4:27086465-27086487 GGACCATGGCTAGCTACTCTAGG + Intergenic
976363414 4:84206525-84206547 GATCTATAGATGGCCACTCTGGG - Intergenic
986003792 5:3650734-3650756 AAACCATGCATTGCTATTCTGGG + Intergenic
988427893 5:31085065-31085087 GAAGCTTGGGTGGCAACTCTAGG + Intergenic
992498404 5:77316971-77316993 GAACCAAGGATGGCTTCACATGG + Intronic
993834135 5:92795856-92795878 GGTCTATGGATGGCCACTCTGGG - Intergenic
1000691542 5:164327395-164327417 GGTCTATGGATGGCTGCTCTGGG - Intergenic
1002930632 6:1632375-1632397 TAACCATGGATGCCTCTTCTGGG - Intronic
1009630842 6:66198208-66198230 GGCCTATGGATGGCCACTCTGGG + Intergenic
1009895704 6:69746406-69746428 AGACCATGGATGGCCCCTCTGGG + Intronic
1012325775 6:97915110-97915132 GAATCATGGTAGGCTACTCCGGG - Intergenic
1013099825 6:106976712-106976734 CAACCATGCATGGCTAATTTTGG - Intergenic
1013403272 6:109819320-109819342 GAGCCCTGGATGGCTACCCAAGG - Intronic
1024784193 7:52887070-52887092 GATTCATGGCTGGCTGCTCTAGG + Intergenic
1036594363 8:10199121-10199143 GAATCATGGATGCCTGCTTTGGG + Intronic
1040644761 8:49385777-49385799 AAGCCATGGATGAATACTCTAGG + Intergenic
1044261981 8:90135848-90135870 GATCAATTCATGGCTACTCTTGG - Intergenic
1045555746 8:103213178-103213200 GGACCAGGGATGGCTCATCTTGG + Intronic
1046758930 8:118000439-118000461 GAACCAAGGCTTGCAACTCTAGG - Intronic
1049246991 8:141568150-141568172 GAACCATGGCTTTCTCCTCTAGG + Intergenic
1049624513 8:143614013-143614035 GGACCAGAGATGGCTCCTCTTGG + Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1055663138 9:78526816-78526838 AAACCACAGATGGCTACTTTAGG - Intergenic
1056799325 9:89680573-89680595 GAACCATGCATGGCTCCTCATGG + Intergenic
1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG + Intergenic
1059094881 9:111401674-111401696 GGTCTATGAATGGCTACTCTGGG - Intronic
1189892802 X:45623125-45623147 GAATGATGGATGGATATTCTAGG + Intergenic
1195174019 X:102297453-102297475 GAGCCATGGAAGTTTACTCTTGG + Intergenic
1195184846 X:102389640-102389662 GAGCCATGGAAGTTTACTCTTGG - Intronic
1197729085 X:129795001-129795023 GCACCAGGAAGGGCTACTCTGGG - Exonic