ID: 1104428415

View in Genome Browser
Species Human (GRCh38)
Location 12:128696697-128696719
Sequence CCATTTCCACATATGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104428415_1104428424 26 Left 1104428415 12:128696697-128696719 CCTTACACCATATGTGGAAATGG 0: 1
1: 0
2: 0
3: 23
4: 251
Right 1104428424 12:128696746-128696768 GACATCTCAAGCCCAACATTTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1104428415_1104428418 4 Left 1104428415 12:128696697-128696719 CCTTACACCATATGTGGAAATGG 0: 1
1: 0
2: 0
3: 23
4: 251
Right 1104428418 12:128696724-128696746 CACATTCCCGTCATTTCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104428415 Original CRISPR CCATTTCCACATATGGTGTA AGG (reversed) Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
905875525 1:41429716-41429738 CCATTTCTACATCTGGAGAATGG - Intergenic
905897254 1:41556802-41556824 TCATTTCTGTATATGGTGTAAGG + Intronic
906735676 1:48124591-48124613 TGATTTTCACATATGGTGAAAGG + Intergenic
907315581 1:53568769-53568791 AAATTTACACTTATGGTGTAAGG - Intronic
907390896 1:54157641-54157663 CCATGTCCTCACATGGTGGAAGG + Intronic
907956579 1:59233774-59233796 CCCTGCCCACATATGGTGTAGGG - Intergenic
909596266 1:77409907-77409929 TCATTTTCATATATGGTGTAAGG + Intronic
910722480 1:90301932-90301954 CCATTTCCTGATATGGTGGAGGG - Intergenic
910764977 1:90772719-90772741 CAATTCCCACCTATGGTGTTTGG - Intergenic
911786973 1:101963197-101963219 CCATTGCCACCCATGGTGTGTGG + Intronic
912614916 1:111089549-111089571 CCATTTCCACCAATAGTGAATGG - Intergenic
913151761 1:116051472-116051494 CCTTTTCAACATATGGTGCTGGG + Intronic
913972640 1:143425859-143425881 CCTTTTCAACATATGATGTTGGG - Intergenic
914067024 1:144251472-144251494 CCTTTTCAACATATGATGTTGGG - Intergenic
914112129 1:144714882-144714904 CCTTTTCAACATATGATGTTGGG + Intergenic
915647548 1:157284512-157284534 CCATGTCCTCATATGGAGAAAGG + Intergenic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
915663125 1:157420128-157420150 CCATGTCCTCATATGGTAGAAGG - Intergenic
915663130 1:157420159-157420181 CCATGTCCTCACATGGTGGAAGG - Intergenic
916142860 1:161714205-161714227 CCACGTCCTCATATGGTGGAAGG - Exonic
919190274 1:194207947-194207969 CCATTTCAACATATGATGCTGGG + Intergenic
919323738 1:196079276-196079298 CCATTTCTTCAGATGGAGTATGG + Intergenic
919598335 1:199591818-199591840 CCATGTCCTCACAAGGTGTAAGG - Intergenic
921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG + Intergenic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
923380033 1:233408032-233408054 CAATTTTCATATATGGTGTGAGG - Intergenic
924727823 1:246686551-246686573 CCATTTCCTCATGTGTTGTCAGG + Intergenic
1062935913 10:1389114-1389136 TCATTTTCACATATGATGTGAGG - Intronic
1063012343 10:2036215-2036237 CCATTTCCTCACATGCTGGAAGG + Intergenic
1063146328 10:3298179-3298201 CCATTTCCACCTCTGCTGTCTGG - Intergenic
1065650780 10:27888886-27888908 ACATTTTTGCATATGGTGTAAGG - Intronic
1066071336 10:31817009-31817031 CCATGTCCCCATATGGTGAAAGG + Intronic
1066278550 10:33891935-33891957 CAATTTCCACATATCGTGTGAGG - Intergenic
1067509777 10:46885169-46885191 CCATGCCCACATTTGGGGTAAGG + Intergenic
1067652477 10:48166689-48166711 CCATGCCCACATTTGGGGTAAGG - Intronic
1067959369 10:50831018-50831040 CCTCTTCAACAAATGGTGTAAGG + Intronic
1070014628 10:72513779-72513801 CCATTTCAACAAATGGTATAAGG - Intronic
1070898922 10:80010719-80010741 AAATTTTCATATATGGTGTAAGG - Intergenic
1071825804 10:89324352-89324374 TGATTTCCATATATGATGTAAGG - Intronic
1073806892 10:107108059-107108081 CCATTTCAAGATCTGCTGTAGGG - Intronic
1074723628 10:116285319-116285341 CCATTTCAACATCTGGCGGAGGG + Intergenic
1075538407 10:123291545-123291567 CCTTTTCAACATATGGTGCTGGG + Intergenic
1076592405 10:131593325-131593347 TAATTTCTGCATATGGTGTAAGG + Intergenic
1076592722 10:131598025-131598047 TAATTTCTGCATATGGTGTAAGG + Intergenic
1078551688 11:12285624-12285646 GCATTTTCACAAATGGAGTAAGG + Intronic
1079520590 11:21321794-21321816 ACAGTCCCACACATGGTGTAAGG + Intronic
1080972881 11:37300661-37300683 ACATTTCAAAATATGGTTTAAGG - Intergenic
1081610486 11:44559900-44559922 CCATTTCCACATCTTGGGAATGG + Intergenic
1082037880 11:47660390-47660412 CCATTTCCAAATATGTAGTTAGG + Intronic
1084608984 11:70188807-70188829 GCATTTCCACAGATGGTGTCAGG + Exonic
1085153867 11:74275339-74275361 TAATTTTCATATATGGTGTAAGG + Intronic
1085487507 11:76879286-76879308 TTATTGTCACATATGGTGTAAGG + Intronic
1086139762 11:83483766-83483788 CCATTGCCACATATGTTTTTTGG - Intronic
1086937502 11:92761253-92761275 TCATGTCCTCATATGGTGGAAGG + Intronic
1087602432 11:100333693-100333715 CCATTTCAACAAATGGTGCTGGG + Intronic
1088285038 11:108179199-108179221 AAATTTTCATATATGGTGTAAGG - Intronic
1088763493 11:112954282-112954304 CCTTTTCTACAAATGGTGTTGGG + Intergenic
1089718401 11:120387132-120387154 AGATTTTCACATATGGTCTATGG + Intronic
1090327020 11:125897165-125897187 CCATCTCCACATCTGTTCTAAGG + Intronic
1091284503 11:134400585-134400607 TCATTTTCACATATGGTGAGAGG - Intronic
1092663449 12:10765783-10765805 CCATGTCCTTATATGTTGTAAGG + Intergenic
1093189023 12:16053785-16053807 AAATTTGCATATATGGTGTAAGG - Intergenic
1093978526 12:25450412-25450434 CAATTCCCACATATTGTGTGAGG + Intronic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095333718 12:41001790-41001812 TCATTTTCATATATGGTGTAAGG + Intronic
1096063182 12:48719353-48719375 CAATTTCCACATATGGTAGGAGG - Intergenic
1098009829 12:66039073-66039095 CCAGTTACACATATGTTGCATGG + Intergenic
1098938871 12:76511889-76511911 TCATTTTTATATATGGTGTAAGG + Intronic
1099795292 12:87392823-87392845 CCCTTCCCACATATGAAGTAAGG + Intergenic
1101286289 12:103316675-103316697 ACAGTTACACATATGGTATATGG - Intronic
1101979875 12:109396740-109396762 CCATTTCCCCATTTGTTGAATGG + Intronic
1104428415 12:128696697-128696719 CCATTTCCACATATGGTGTAAGG - Intronic
1105876870 13:24563183-24563205 CCAATTCTACATATGATTTATGG - Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1110536969 13:76661904-76661926 TCATTTCGGCATATGGTGTGAGG - Intergenic
1110559906 13:76899543-76899565 CCATTCCCACATATTGTGGGAGG - Intergenic
1110971421 13:81767014-81767036 TAATTTCCACATATGGTGAAAGG - Intergenic
1111336569 13:86833208-86833230 CCTTTTCTACAAATGGTGTTGGG + Intergenic
1113211410 13:107986318-107986340 TGATTTACAGATATGGTGTAAGG + Intergenic
1115059405 14:29171526-29171548 CTTTTTCCACATATGGTCAAAGG - Intergenic
1115737695 14:36352410-36352432 CCATTTCCAGATATTTTGAATGG - Intergenic
1115805916 14:37051591-37051613 CTATTTACAAATATGGTGCAGGG + Intronic
1118016423 14:61665786-61665808 CCATTTCCATTTTTGATGTAGGG + Intergenic
1118515292 14:66521624-66521646 CTATGTCCACATATGTTGGAAGG + Intronic
1119198580 14:72735772-72735794 CCATTTCCATATGTGGTAAATGG + Intronic
1120594336 14:86415463-86415485 CAATTTCCACATGTTGTGGAAGG - Intergenic
1120641880 14:87024191-87024213 CTATTTTGGCATATGGTGTAAGG + Intergenic
1124555881 15:30725403-30725425 ACATTTCCAGCTATGCTGTAGGG + Intronic
1124675397 15:31680355-31680377 ACATTTCCAGCTATGCTGTAGGG - Intronic
1124793700 15:32754490-32754512 CTGTTTCCACTTATGGTGGAAGG - Intergenic
1129225393 15:74167584-74167606 ATATTTACACATATGGTATATGG + Intergenic
1131663727 15:94546680-94546702 CTACATCCACATATGGTGTCAGG - Intergenic
1134225826 16:12389312-12389334 CCATTCCCACATGTTGTGGAAGG + Intronic
1135208520 16:20503561-20503583 CCATTTCCAAATCTGGAGTTAGG - Intergenic
1135230870 16:20706612-20706634 CCATTTCCAAATCTGGGGTTAGG - Intronic
1139369974 16:66460958-66460980 CAAGTACCACGTATGGTGTAAGG + Intronic
1139462627 16:67134717-67134739 CCGTATCCTCATATGGTGCAAGG + Intronic
1140075238 16:71692472-71692494 TCATTTCCTCATATTGTATATGG - Intronic
1140704596 16:77614982-77615004 CTACTTCCACTTATGGTGGAAGG + Intergenic
1146099452 17:29965557-29965579 TAATTTTCATATATGGTGTAAGG + Intronic
1149384877 17:56132756-56132778 CCATGTCCTCACATGGTGGAAGG + Intronic
1149937716 17:60825695-60825717 CCATGTCCTCACATGGTGGAAGG + Intronic
1150545033 17:66147741-66147763 TCATTTCCACAAATGGTGTTGGG - Intronic
1155518734 18:26648253-26648275 CCATTTCCAGAAATGGTGAATGG - Intronic
1156061272 18:33079251-33079273 CCATTTTTGTATATGGTGTAAGG - Intronic
1157017601 18:43736198-43736220 CCATTTCCACAAATGCTTTCAGG - Intergenic
1157439245 18:47697374-47697396 CCAATTCTCCAAATGGTGTATGG - Intergenic
1159531096 18:69656479-69656501 CCATTTCCACATATGTTCAGTGG + Intronic
1164239072 19:23367847-23367869 AGATTTTCACATATGGTTTAAGG - Intronic
1164318776 19:24119152-24119174 ATTTTTCCACATATGGTTTAAGG + Intronic
1164971044 19:32532928-32532950 CCATTTCCCCTTAGGGTGTTGGG - Intergenic
1165911132 19:39228616-39228638 CCTTTTCAACAAATGGTGTTTGG + Intergenic
1168014099 19:53557371-53557393 CCATGGCCACACATGGTGAAAGG + Intronic
925773377 2:7306717-7306739 TCATTTTTGCATATGGTGTAAGG + Intergenic
933477301 2:82807333-82807355 TAATTTTCATATATGGTGTAAGG - Intergenic
933505675 2:83174481-83174503 CTATTTCCTCACATGGTGGAAGG + Intergenic
935774995 2:106465662-106465684 CCTTTTCCACAAATGTTTTAAGG - Intronic
935905073 2:107830233-107830255 CCTTTTCCACAGATGTTTTAAGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
935991237 2:108720414-108720436 CCTTTTCCACAAATGTTTTAAGG + Intronic
936126854 2:109795317-109795339 CCTTTTCCACAGATGTTTTAAGG + Intronic
936217843 2:110576169-110576191 CCTTTTCCACAGATGTTTTAAGG - Intronic
936700920 2:115010652-115010674 CCATTTCCAGATATGATATGTGG - Intronic
937410282 2:121669117-121669139 AGATTTCTACATATGGTGTGAGG - Intergenic
940923239 2:159333451-159333473 CCATGTACACATATTCTGTACGG + Intronic
940945261 2:159608968-159608990 GCGTTTCCACACATGGTGTTAGG - Intronic
941737522 2:168995470-168995492 CCATTTCCAGATATGCTTTTGGG - Exonic
942627680 2:177920173-177920195 TAATTTCCACATATAGGGTATGG - Intronic
944087931 2:195870703-195870725 CCATGTCCTCAAATGGTGGAAGG - Intronic
945609672 2:211984162-211984184 CCATGTCCTCACATGGTGGAAGG + Intronic
948432156 2:237926159-237926181 TAATTTTCACATATGGTGTGAGG - Intergenic
1169335683 20:4754374-4754396 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1171507079 20:25645794-25645816 CAATTTTTATATATGGTGTAAGG + Intergenic
1175605093 20:60306252-60306274 CCATTACCAGATAAGGTGGAGGG + Intergenic
1177587411 21:23116272-23116294 CCCATAACACATATGGTGTATGG + Intergenic
1177864685 21:26499152-26499174 CCCTTTCCAAATATGGTTCAGGG - Intronic
1180251147 21:46590187-46590209 CCTTTTCAACAAATGGTGTGGGG + Intergenic
1180391151 22:12283504-12283526 CTGTTTCCTCATATGGTGGAAGG + Intergenic
1181681627 22:24499539-24499561 CCAGTTCTACATCTGGTGTTGGG - Intronic
1184015715 22:41784344-41784366 CCATTTCCACAGAGAGTGTCTGG - Exonic
949528082 3:4925909-4925931 CCTTTTCAACAAATGGTGTTGGG + Intergenic
950430851 3:12950144-12950166 CCATTTTCTCATATGGAGAATGG - Intronic
950587615 3:13906210-13906232 TAATTTCTGCATATGGTGTAAGG - Intergenic
950591986 3:13943409-13943431 CCTTTTCCACAAATGGTGCTGGG - Intronic
951434926 3:22650859-22650881 CCTTTTCAACAAATGGTGCAGGG + Intergenic
953539874 3:43808229-43808251 CCTTTTCAACAAATGGTGTTGGG + Intergenic
954433231 3:50482456-50482478 CCATTTCCACATTTGGAAAATGG + Intronic
955057952 3:55472995-55473017 CCATTTCCACATCTGTTAAATGG - Intronic
955775198 3:62425357-62425379 ACATTTCCAAATGTGCTGTAGGG + Intronic
958140750 3:89559381-89559403 CCATGTACAAATCTGGTGTAAGG - Intergenic
958593203 3:96187194-96187216 CTATGTCCTCATATGGTGGAAGG - Intergenic
959140409 3:102479718-102479740 ACATTTGCACATATTTTGTAAGG - Exonic
959457598 3:106581974-106581996 CCTTTTCCAAATATATTGTAAGG - Intergenic
959779142 3:110207050-110207072 TGATTTTCATATATGGTGTAAGG - Intergenic
959891678 3:111563050-111563072 CCATGTCCTCACATGGTGGAAGG + Intronic
960229667 3:115210312-115210334 CCATTCTTACCTATGGTGTAGGG - Intergenic
962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG + Exonic
968250541 3:197207037-197207059 TCATTTCCATGTATGATGTATGG + Intronic
969045642 4:4334654-4334676 CCATTCCCACCAATGGTGCATGG - Intergenic
969873607 4:10119850-10119872 CAATGAACACATATGGTGTATGG + Intergenic
971088899 4:23316385-23316407 CAATTAACACATATGTTGTATGG - Intergenic
972410110 4:38785078-38785100 GTATTTCCACATATATTGTAGGG + Intergenic
972497088 4:39644166-39644188 ACATTTCTCCATATGCTGTAGGG - Intergenic
973308610 4:48681878-48681900 CTATTTCCAAATATTTTGTAGGG - Intronic
973972459 4:56226962-56226984 CTACTTCCACTTATGGTGTAAGG - Intronic
974402775 4:61426624-61426646 CCAGTTCCACATATGGCCTCTGG + Intronic
974916672 4:68186400-68186422 CCATTGCCTTACATGGTGTATGG - Intergenic
979697313 4:123627886-123627908 CCCTTTCCACAAAGGATGTATGG - Intergenic
979712679 4:123798661-123798683 GAATTTTTACATATGGTGTAAGG + Intergenic
979925565 4:126558804-126558826 CCGTGTCCTCATATGGTGGAAGG - Intergenic
979963454 4:127049174-127049196 CCATTTCCACATAGCTTGTTGGG + Intergenic
984423622 4:179555843-179555865 CCAATTCCTCATATGGGGTAAGG - Intergenic
984453174 4:179929975-179929997 CCATTCCTACATATGGAGAAAGG - Intergenic
985801297 5:2006798-2006820 ACATCTCCACATTTGGTGTAGGG + Intergenic
986476381 5:8138112-8138134 CTATTTCCATATATGCTTTAGGG + Intergenic
987837881 5:23185398-23185420 TCATTTTCTCATATGGTGTAGGG - Intergenic
989046420 5:37278167-37278189 TAATTTTCACATATGGTGTGAGG + Intergenic
989439771 5:41456738-41456760 CTATGTCCTCATATGGTGGAAGG - Intronic
990243944 5:53843721-53843743 CCTTTTCCACAAATGGTGCTTGG + Intergenic
990538700 5:56750559-56750581 CCATTTCCTCACATGGTAGAAGG + Intergenic
992035111 5:72766032-72766054 CCATGTCCCCACATGGTGGAAGG + Intergenic
995908142 5:117151311-117151333 CCATTTCCACAGATCCTGAAAGG - Intergenic
997490749 5:134273822-134273844 CCATCTCCACATTTGCAGTAAGG - Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
1001320630 5:170677983-170678005 CTATTTCCATATAGAGTGTAAGG - Intronic
1001588239 5:172847890-172847912 CCATTTCCAAAGATGTTATAAGG - Intronic
1001923749 5:175621051-175621073 CCATGTCCTCACATGGTGGAAGG - Intergenic
1002323655 5:178390757-178390779 TAATTTCTACATATGGTGTGAGG - Intronic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1007208941 6:40176033-40176055 CCATTTCGAAATATGCTGGATGG - Intergenic
1008688497 6:53950746-53950768 TGATTTTCGCATATGGTGTAAGG - Intronic
1008973166 6:57393894-57393916 CCTTTTCAACAAATGGTGCAGGG - Intronic
1009162072 6:60295433-60295455 CCTTTTCAACAAATGGTGCAGGG - Intergenic
1009335060 6:62477445-62477467 CTATTTCCACATTTTGTTTATGG - Intergenic
1009338710 6:62526920-62526942 CTGTTTCCTCATATGGTGGAAGG - Intergenic
1009532043 6:64830143-64830165 CCATGTCCTCACATGGTGGAAGG - Intronic
1011328677 6:86179399-86179421 CCTTTTCCACAAATGGTGCTGGG - Intergenic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1012384880 6:98668743-98668765 CCATTGCCACAGATAGTGTGTGG - Intergenic
1012541946 6:100371598-100371620 CCACTTACACTTCTGGTGTATGG - Intergenic
1012586595 6:100930861-100930883 TGATTTTCATATATGGTGTAAGG + Intergenic
1015656559 6:135525169-135525191 CTGTTTCCCCATATGGTGGAAGG - Intergenic
1016641706 6:146356793-146356815 CCATATACATATATGGTGTGTGG + Intronic
1016972468 6:149777028-149777050 CAATGTCCACAAATGGTGGATGG + Intronic
1017250201 6:152272008-152272030 CCAAATCCAAATTTGGTGTAAGG - Intronic
1017429597 6:154358133-154358155 CCATGTCCTCATATGGTGGAGGG - Intronic
1017534872 6:155336298-155336320 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1017608343 6:156157151-156157173 CATTTTACACATATGGTGGATGG - Intergenic
1020747027 7:12091208-12091230 CCAAGTCCACATATGGTCTTTGG - Intergenic
1021651830 7:22840210-22840232 CCAGTTCCCCATATTCTGTATGG - Intergenic
1022644905 7:32220851-32220873 CCAATTCCACATATCATGCATGG + Intronic
1023594371 7:41813402-41813424 CCATTTCCTCATAATGTATATGG - Intergenic
1023672130 7:42588143-42588165 CCACTTCCACAAAAGGTGGAAGG - Intergenic
1024221518 7:47291916-47291938 CCATTTCTACATCTGGTGACTGG - Intronic
1026416312 7:70184385-70184407 CCATTTCCAGAGAAGGTGGAGGG - Intronic
1027802886 7:82777732-82777754 TGATTTCTGCATATGGTGTAAGG - Intronic
1028526190 7:91789643-91789665 CCATTTCCACAAATGTGGCATGG + Intronic
1029015266 7:97309753-97309775 TCATTTTCATATAAGGTGTAAGG - Intergenic
1030071061 7:105697928-105697950 CCTCTTCCACATATGGAGTCAGG - Intronic
1031035495 7:116784034-116784056 CCACTTCTCCATATGGTGGAAGG - Intronic
1031267816 7:119604121-119604143 TAATTTCCATATATGGTGAAAGG - Intergenic
1031301479 7:120066959-120066981 TCATTCCCACATATTGTGGAAGG + Intergenic
1031681061 7:124675210-124675232 CCATGTCCTCATATGGTGGAAGG - Intergenic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1038173295 8:25158552-25158574 TAATTTTTACATATGGTGTAAGG + Intergenic
1038719974 8:30026939-30026961 TAATTTTTACATATGGTGTAAGG - Intergenic
1039092152 8:33843787-33843809 CCAGTACCAATTATGGTGTATGG - Intergenic
1039597234 8:38801381-38801403 CAGTTTCTGCATATGGTGTAAGG + Intronic
1040034307 8:42853998-42854020 CCAATTACACATTTGGTGTGGGG - Exonic
1041460265 8:58103684-58103706 TCATATTCACATATGCTGTATGG - Intronic
1044155024 8:88835206-88835228 ACATTTCCACAAATGATGTTGGG + Intergenic
1045706185 8:104925953-104925975 TAATTTCCACATATTGTGAAAGG + Intronic
1046558520 8:115807892-115807914 CCATTTCAACGTATGGACTACGG - Intronic
1046839723 8:118842840-118842862 CTATTTCCACTCATGGTGGAAGG - Intergenic
1048495103 8:134928672-134928694 CCATTTCCATATAGAGTATAAGG - Intergenic
1048835918 8:138518756-138518778 CCTTTTCCACATATTCTGCAGGG + Intergenic
1052052904 9:23867999-23868021 CCATTTCTTCATTTGGGGTATGG - Intergenic
1052710617 9:32051060-32051082 TCATTTTCATATAAGGTGTAAGG + Intergenic
1055071634 9:72172632-72172654 CCACATCCAGGTATGGTGTAGGG - Intronic
1055187471 9:73474094-73474116 CCATTTCCTCATCTGGTAGACGG + Intergenic
1055332285 9:75197024-75197046 CTGCTTCCACTTATGGTGTAAGG + Intergenic
1055633935 9:78255552-78255574 CCATGTCCTCACATGGTGGAAGG + Intronic
1056701859 9:88917788-88917810 CCATTCCCACATCTGATGTGAGG - Intergenic
1057268197 9:93632567-93632589 CCATGTCCTCATATGGTGGAAGG + Intronic
1057498027 9:95575484-95575506 CCATTCCCACGTGTGGTGCACGG - Intergenic
1059600496 9:115772233-115772255 CCATTTCCTCAGATGGTGTCTGG - Intergenic
1062702363 9:137914006-137914028 CCAGTTCCTCACATGCTGTATGG + Intronic
1186208418 X:7224562-7224584 CCATGTTCTCATATGGTGGAAGG - Intronic
1186291990 X:8110370-8110392 TTATTTCTACATATGGTGTAAGG + Intergenic
1187777521 X:22778977-22778999 TCTTTTCAACATATGGTGTTGGG - Intergenic
1188148746 X:26646660-26646682 CAATTTTCATATATGGTGAAAGG + Intergenic
1189139411 X:38585873-38585895 CTACTTCCACACATGGTGGAAGG - Intronic
1190067066 X:47248766-47248788 CCATTTCCACATTGCCTGTAGGG - Intergenic
1192615013 X:72610728-72610750 CCATTCCCACTAATGGTGTATGG + Intronic
1192820642 X:74641593-74641615 CCTTTTCAACAAATGGTGTTGGG + Intergenic
1193144738 X:78065028-78065050 CCCTTTTCACAGATGGTATAAGG + Intergenic
1193325443 X:80174614-80174636 CCTTTTCAACAAATGGTGTGGGG - Intergenic
1193784969 X:85749853-85749875 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1195686703 X:107593627-107593649 CCTTTTCAACAAATGGTGTTGGG - Intronic
1196528936 X:116760307-116760329 TGATTTCCTTATATGGTGTAAGG - Intergenic
1196941014 X:120775843-120775865 CTCTTTCCTCATATGGTGGAAGG - Intergenic
1197525560 X:127557942-127557964 CCATTTCAACAAATGGTGCTGGG - Intergenic
1197580152 X:128272306-128272328 ACCTTTCCAAATATGGTGAAAGG + Intergenic
1197641750 X:128975542-128975564 CCATTTCCACTAAATGTGTAGGG + Intergenic
1198070472 X:133143350-133143372 CTACTTCCACTTATGGTGGAAGG - Intergenic
1198146633 X:133864010-133864032 CCCTTCCCACAGATGGTGTCTGG + Intronic
1198436628 X:136623267-136623289 CCATTTCCTCATCTGTTGTGGGG + Intergenic
1199274204 X:145922943-145922965 CCAGTTCCACACAGGTTGTATGG - Intergenic
1199434839 X:147801850-147801872 CCTTTTCCAGATATGTTCTATGG - Intergenic
1199435023 X:147803271-147803293 CCTTTTCCAAATATGTTCTATGG - Intergenic
1199971668 X:152866216-152866238 CCATGTCCTCACATGGTGGAAGG + Intronic
1200036049 X:153331496-153331518 CCATGTCCTCATATGGTGGAAGG + Intergenic
1200544228 Y:4499027-4499049 TAATTTCTGCATATGGTGTAAGG - Intergenic