ID: 1104433309

View in Genome Browser
Species Human (GRCh38)
Location 12:128734398-128734420
Sequence TCTCTTCTTGCCACGACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104433309_1104433310 -7 Left 1104433309 12:128734398-128734420 CCTGATGTCGTGGCAAGAAGAGA No data
Right 1104433310 12:128734414-128734436 GAAGAGAGCAGAGAAGACAAAGG No data
1104433309_1104433311 -4 Left 1104433309 12:128734398-128734420 CCTGATGTCGTGGCAAGAAGAGA No data
Right 1104433311 12:128734417-128734439 GAGAGCAGAGAAGACAAAGGAGG No data
1104433309_1104433312 -3 Left 1104433309 12:128734398-128734420 CCTGATGTCGTGGCAAGAAGAGA No data
Right 1104433312 12:128734418-128734440 AGAGCAGAGAAGACAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104433309 Original CRISPR TCTCTTCTTGCCACGACATC AGG (reversed) Intergenic
No off target data available for this crispr