ID: 1104434605

View in Genome Browser
Species Human (GRCh38)
Location 12:128745837-128745859
Sequence CAAAACCATATGATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104434605_1104434609 6 Left 1104434605 12:128745837-128745859 CCCCAAAACATCATATGGTTTTG No data
Right 1104434609 12:128745866-128745888 AGAGAAGAGAGAATGCATGCAGG No data
1104434605_1104434611 12 Left 1104434605 12:128745837-128745859 CCCCAAAACATCATATGGTTTTG No data
Right 1104434611 12:128745872-128745894 GAGAGAATGCATGCAGGACTGGG No data
1104434605_1104434610 11 Left 1104434605 12:128745837-128745859 CCCCAAAACATCATATGGTTTTG No data
Right 1104434610 12:128745871-128745893 AGAGAGAATGCATGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104434605 Original CRISPR CAAAACCATATGATGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr