ID: 1104434609

View in Genome Browser
Species Human (GRCh38)
Location 12:128745866-128745888
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104434606_1104434609 5 Left 1104434606 12:128745838-128745860 CCCAAAACATCATATGGTTTTGT No data
Right 1104434609 12:128745866-128745888 AGAGAAGAGAGAATGCATGCAGG No data
1104434607_1104434609 4 Left 1104434607 12:128745839-128745861 CCAAAACATCATATGGTTTTGTG No data
Right 1104434609 12:128745866-128745888 AGAGAAGAGAGAATGCATGCAGG No data
1104434605_1104434609 6 Left 1104434605 12:128745837-128745859 CCCCAAAACATCATATGGTTTTG No data
Right 1104434609 12:128745866-128745888 AGAGAAGAGAGAATGCATGCAGG No data
1104434604_1104434609 7 Left 1104434604 12:128745836-128745858 CCCCCAAAACATCATATGGTTTT No data
Right 1104434609 12:128745866-128745888 AGAGAAGAGAGAATGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104434609 Original CRISPR AGAGAAGAGAGAATGCATGC AGG Intergenic
No off target data available for this crispr