ID: 1104435472

View in Genome Browser
Species Human (GRCh38)
Location 12:128752915-128752937
Sequence AGGGGTGTTCACTTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104435472_1104435479 4 Left 1104435472 12:128752915-128752937 CCCTTCTCCAAGTGAACACCCCT No data
Right 1104435479 12:128752942-128752964 AGACAGGCTCTGACCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104435472 Original CRISPR AGGGGTGTTCACTTGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr