ID: 1104436927

View in Genome Browser
Species Human (GRCh38)
Location 12:128764157-128764179
Sequence TTCTGGCCTCTGGAACCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104436927_1104436929 -9 Left 1104436927 12:128764157-128764179 CCTCATGGTTCCAGAGGCCAGAA No data
Right 1104436929 12:128764171-128764193 AGGCCAGAAGCCCAAAATCAAGG No data
1104436927_1104436933 2 Left 1104436927 12:128764157-128764179 CCTCATGGTTCCAGAGGCCAGAA No data
Right 1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104436927 Original CRISPR TTCTGGCCTCTGGAACCATG AGG (reversed) Intergenic
No off target data available for this crispr