ID: 1104436927 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:128764157-128764179 |
| Sequence | TTCTGGCCTCTGGAACCATG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104436927_1104436933 | 2 | Left | 1104436927 | 12:128764157-128764179 | CCTCATGGTTCCAGAGGCCAGAA | No data | ||
| Right | 1104436933 | 12:128764182-128764204 | CCAAAATCAAGGCTTCGCTGAGG | No data | ||||
| 1104436927_1104436929 | -9 | Left | 1104436927 | 12:128764157-128764179 | CCTCATGGTTCCAGAGGCCAGAA | No data | ||
| Right | 1104436929 | 12:128764171-128764193 | AGGCCAGAAGCCCAAAATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104436927 | Original CRISPR | TTCTGGCCTCTGGAACCATG AGG (reversed) | Intergenic | ||