ID: 1104436928

View in Genome Browser
Species Human (GRCh38)
Location 12:128764167-128764189
Sequence GATTTTGGGCTTCTGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104436928_1104436933 -8 Left 1104436928 12:128764167-128764189 CCAGAGGCCAGAAGCCCAAAATC No data
Right 1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104436928 Original CRISPR GATTTTGGGCTTCTGGCCTC TGG (reversed) Intergenic
No off target data available for this crispr