ID: 1104436933

View in Genome Browser
Species Human (GRCh38)
Location 12:128764182-128764204
Sequence CCAAAATCAAGGCTTCGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104436927_1104436933 2 Left 1104436927 12:128764157-128764179 CCTCATGGTTCCAGAGGCCAGAA No data
Right 1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG No data
1104436928_1104436933 -8 Left 1104436928 12:128764167-128764189 CCAGAGGCCAGAAGCCCAAAATC No data
Right 1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG No data
1104436925_1104436933 8 Left 1104436925 12:128764151-128764173 CCGTGGCCTCATGGTTCCAGAGG No data
Right 1104436933 12:128764182-128764204 CCAAAATCAAGGCTTCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104436933 Original CRISPR CCAAAATCAAGGCTTCGCTG AGG Intergenic