ID: 1104436933 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:128764182-128764204 |
Sequence | CCAAAATCAAGGCTTCGCTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104436927_1104436933 | 2 | Left | 1104436927 | 12:128764157-128764179 | CCTCATGGTTCCAGAGGCCAGAA | No data | ||
Right | 1104436933 | 12:128764182-128764204 | CCAAAATCAAGGCTTCGCTGAGG | No data | ||||
1104436928_1104436933 | -8 | Left | 1104436928 | 12:128764167-128764189 | CCAGAGGCCAGAAGCCCAAAATC | No data | ||
Right | 1104436933 | 12:128764182-128764204 | CCAAAATCAAGGCTTCGCTGAGG | No data | ||||
1104436925_1104436933 | 8 | Left | 1104436925 | 12:128764151-128764173 | CCGTGGCCTCATGGTTCCAGAGG | No data | ||
Right | 1104436933 | 12:128764182-128764204 | CCAAAATCAAGGCTTCGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104436933 | Original CRISPR | CCAAAATCAAGGCTTCGCTG AGG | Intergenic | ||