ID: 1104440190

View in Genome Browser
Species Human (GRCh38)
Location 12:128787899-128787921
Sequence GGCCACACTGGATTCATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104440190_1104440198 24 Left 1104440190 12:128787899-128787921 CCCCACATGAATCCAGTGTGGCC No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104440190 Original CRISPR GGCCACACTGGATTCATGTG GGG (reversed) Intergenic