ID: 1104440198

View in Genome Browser
Species Human (GRCh38)
Location 12:128787946-128787968
Sequence AAAGACACTTTGTCCAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104440190_1104440198 24 Left 1104440190 12:128787899-128787921 CCCCACATGAATCCAGTGTGGCC No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440195_1104440198 2 Left 1104440195 12:128787921-128787943 CCCATCTTAACTTGATTCCATCT No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440196_1104440198 1 Left 1104440196 12:128787922-128787944 CCATCTTAACTTGATTCCATCTG No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440194_1104440198 3 Left 1104440194 12:128787920-128787942 CCCCATCTTAACTTGATTCCATC No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440192_1104440198 22 Left 1104440192 12:128787901-128787923 CCACATGAATCCAGTGTGGCCCC No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440191_1104440198 23 Left 1104440191 12:128787900-128787922 CCCACATGAATCCAGTGTGGCCC No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data
1104440193_1104440198 12 Left 1104440193 12:128787911-128787933 CCAGTGTGGCCCCATCTTAACTT No data
Right 1104440198 12:128787946-128787968 AAAGACACTTTGTCCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104440198 Original CRISPR AAAGACACTTTGTCCAAATG AGG Intergenic