ID: 1104440700

View in Genome Browser
Species Human (GRCh38)
Location 12:128791169-128791191
Sequence TACAGCCCGTCCGCAAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 24}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104440690_1104440700 23 Left 1104440690 12:128791123-128791145 CCTGGGGGTGGGGGGCACGAGGC 0: 1
1: 0
2: 4
3: 54
4: 510
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440696_1104440700 -4 Left 1104440696 12:128791150-128791172 CCCAGGGACCCTGTACTTGTACA 0: 1
1: 2
2: 1
3: 7
4: 73
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440694_1104440700 1 Left 1104440694 12:128791145-128791167 CCGGCCCCAGGGACCCTGTACTT 0: 1
1: 0
2: 2
3: 51
4: 507
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440697_1104440700 -5 Left 1104440697 12:128791151-128791173 CCAGGGACCCTGTACTTGTACAG 0: 1
1: 1
2: 2
3: 6
4: 113
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440687_1104440700 25 Left 1104440687 12:128791121-128791143 CCCCTGGGGGTGGGGGGCACGAG 0: 1
1: 0
2: 2
3: 37
4: 297
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440688_1104440700 24 Left 1104440688 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG 0: 1
1: 1
2: 4
3: 59
4: 418
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1104440695_1104440700 -3 Left 1104440695 12:128791149-128791171 CCCCAGGGACCCTGTACTTGTAC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104440700 Original CRISPR TACAGCCCGTCCGCAAATTC AGG Intergenic
907905547 1:58781819-58781841 GACAGCCCGTCCGCAAAGCGGGG + Exonic
916697891 1:167258958-167258980 TACAGCCTGTACGCAAAATCTGG - Intronic
1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG + Intergenic
1111170331 13:84518769-84518791 TCCAGCCCACCAGCAAATTCTGG - Intergenic
1126949750 15:53868216-53868238 AACAGCCTGCCTGCAAATTCAGG - Intergenic
1127475700 15:59330720-59330742 TACAGCCCGTGAGCCAAATCTGG + Intronic
1129534157 15:76298003-76298025 TAAAGCCCATCTGCAAATTTAGG + Intronic
1133849685 16:9490579-9490601 TGGAGCCAGTCTGCAAATTCAGG + Intergenic
1152168052 17:78723667-78723689 TGCAGCCTGTGCGCAAATGCTGG - Intronic
1157238966 18:45991604-45991626 TACAGCCAGTCAGCAAACTATGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
942153277 2:173100252-173100274 TAAAGCCCTTCACCAAATTCAGG - Intronic
943636288 2:190310276-190310298 GATAGGCCGTCCGCAAATTGAGG - Intronic
946018285 2:216621434-216621456 TACAGCCTGTAAGCCAATTCTGG + Intergenic
1175625871 20:60487832-60487854 AACAGGCCGTCTGCAAGTTCAGG + Intergenic
1179512500 21:41882990-41883012 AACAGCCAGTGCTCAAATTCTGG + Intergenic
1179613750 21:42568692-42568714 TACAGCCCGTGGGCTAACTCAGG + Intronic
954505030 3:51061968-51061990 TCTAGTCCGTCAGCAAATTCTGG + Intronic
958457494 3:94349646-94349668 TACAGCCCCTCCCCAACCTCAGG + Intergenic
965057904 3:163745221-163745243 AACAGCCTGTGCTCAAATTCAGG - Intergenic
971175301 4:24276968-24276990 TACAGACCGCCCTCAAATTCAGG + Intergenic
982637859 4:157919667-157919689 TACAGCCCGTCACCAAAGCCTGG + Intergenic
1031689557 7:124770496-124770518 TACAGCTTGTACCCAAATTCTGG - Intergenic
1048613332 8:136048058-136048080 TACAGTCTGTCCGCAAATCCTGG + Intergenic
1050032929 9:1405295-1405317 TACAACCCGTCTTCAGATTCAGG - Intergenic
1055050979 9:71980506-71980528 TACAACATGTCCGCAAAGTCAGG + Intronic
1187008828 X:15259161-15259183 TACAGCCAGTCCTCAAACTAAGG + Intronic
1190112012 X:47596543-47596565 TAGAGCCCATCAGCAAAGTCTGG + Intronic