ID: 1104444439

View in Genome Browser
Species Human (GRCh38)
Location 12:128822487-128822509
Sequence CCTTCTGGTCTGAACTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104444431_1104444439 19 Left 1104444431 12:128822445-128822467 CCCCATGTCTGGAAAGCTCCTCA 0: 1
1: 0
2: 3
3: 12
4: 204
Right 1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG 0: 1
1: 0
2: 3
3: 5
4: 121
1104444434_1104444439 1 Left 1104444434 12:128822463-128822485 CCTCAAACAACTGCTCTTTCCTA 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG 0: 1
1: 0
2: 3
3: 5
4: 121
1104444432_1104444439 18 Left 1104444432 12:128822446-128822468 CCCATGTCTGGAAAGCTCCTCAA 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG 0: 1
1: 0
2: 3
3: 5
4: 121
1104444430_1104444439 28 Left 1104444430 12:128822436-128822458 CCTGCGAATCCCCATGTCTGGAA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG 0: 1
1: 0
2: 3
3: 5
4: 121
1104444433_1104444439 17 Left 1104444433 12:128822447-128822469 CCATGTCTGGAAAGCTCCTCAAA 0: 1
1: 0
2: 0
3: 17
4: 181
Right 1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG 0: 1
1: 0
2: 3
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104444439 Original CRISPR CCTTCTGGTCTGAACTTACA GGG Intronic
901496537 1:9625763-9625785 CCTTTTGGACTGAATTTCCAAGG - Intergenic
904174107 1:28613805-28613827 CCTTCTGCTTTCTACTTACATGG - Intronic
910813469 1:91263279-91263301 CCTTCAGGTGTCAACTTAAATGG - Intronic
916298001 1:163241356-163241378 TCTTCTGGTCTGAACATAGCTGG + Intronic
920206666 1:204297231-204297253 CCTTCTGGTAGGAAAATACATGG + Intronic
921130766 1:212217704-212217726 TCTTCTGGTCTGAACTTGTTTGG + Intergenic
924930940 1:248731885-248731907 CCTTCTGGTGTGTCCTTCCAGGG - Intronic
1064298199 10:14097733-14097755 CATTCTGGTCTAAATTTATAGGG + Intronic
1064521623 10:16209161-16209183 GCTTCAGGTCTGAACTAAAACGG - Intergenic
1071614931 10:87066606-87066628 CCTTCTGGTCTGCACTTAGACGG - Intronic
1072052946 10:91724603-91724625 CCTTCTGTTCTTAATTTAAATGG + Intergenic
1072514870 10:96170368-96170390 CCTTCTGAGCTGGACTTCCAGGG + Intronic
1073922746 10:108478420-108478442 CCTTATGGTCTGTTCTTATAAGG + Intergenic
1074300651 10:112230682-112230704 CCTTTTGGTCTTAACAAACAAGG - Intergenic
1075446089 10:122514122-122514144 CCTCCTGGTCTGACTTTACATGG - Intronic
1076622256 10:131798233-131798255 CCATCTGGTCCAAACTCACAAGG + Intergenic
1078115281 11:8442637-8442659 ACATCTGGTCTGTAGTTACATGG - Intronic
1078153425 11:8778137-8778159 CCTTCTGTTCTGCCCTTTCAAGG - Intronic
1080897198 11:36456499-36456521 CCTTCTCCTCTGAATTTCCAGGG + Intronic
1080930419 11:36804461-36804483 ACTTCTGGTTTAAAATTACAAGG - Intergenic
1082897303 11:58205444-58205466 ACATCAGATCTGAACTTACAAGG + Intergenic
1084318426 11:68359361-68359383 CCCGCTGGTCTGCACTTCCAGGG - Intronic
1088668223 11:112116084-112116106 CCTGTTTGTCTGAACTTAAAAGG + Intronic
1088778161 11:113107110-113107132 TCTACTGGTCTGAGCTTAAATGG - Intronic
1090673338 11:128966789-128966811 GCTGCTGGTGAGAACTTACAGGG + Exonic
1090735890 11:129611903-129611925 CTTTCAGGTCTGAACAGACAGGG + Intergenic
1091278060 11:134365537-134365559 CCTTATGGTGTCAACTCACAGGG + Intronic
1093438831 12:19169403-19169425 TCTTCTGGTCTTCACTTATAGGG + Intronic
1096256241 12:50063897-50063919 ACTTCTGGTCTGAGCTTCTATGG - Intronic
1097614727 12:61870498-61870520 CCTTCTGTTCTGAACAGAGAAGG - Intronic
1101402048 12:104396985-104397007 CCTCCTGGTCTAAAACTACAGGG - Intergenic
1101514405 12:105420893-105420915 CTTTCTGCTCTGAACTTGAAAGG - Intergenic
1102398697 12:112610174-112610196 CCTTCTGGTTTCAGCTTAAATGG + Intronic
1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG + Intronic
1107072795 13:36290059-36290081 CCTTGTGCTATGAAGTTACAGGG + Intronic
1107687413 13:42917346-42917368 CCTTCTGGTCAAAACTTTCATGG - Intronic
1108754922 13:53488128-53488150 CCTTATGGAATGAACTTAAATGG - Intergenic
1108846950 13:54690301-54690323 CCTTGTGGTGTTAAATTACAGGG + Intergenic
1109210772 13:59533331-59533353 CTTTCTGGTCTGTATTTATAAGG + Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1116312853 14:43347528-43347550 CCTGGTGGTGTAAACTTACAAGG + Intergenic
1118597489 14:67447200-67447222 CCTTCTGCTGTGTCCTTACATGG + Intronic
1125121783 15:36168548-36168570 CCTTCTGGTGAGAATTTTCATGG - Intergenic
1127494259 15:59494878-59494900 CCTTCTGAGCTGGATTTACAGGG - Intronic
1130412206 15:83656099-83656121 CATTCTAGTCTGAAATGACAGGG - Intronic
1135152127 16:20017762-20017784 GCATCTGGCCTAAACTTACAGGG - Intergenic
1135816548 16:25639556-25639578 CCTTTTGGTCAGGACTTATAAGG - Intergenic
1135849853 16:25953479-25953501 CCTATTGGGCAGAACTTACATGG - Intronic
1136407725 16:30058301-30058323 CCTTCTGGGCTGTTATTACAAGG - Intronic
1139291906 16:65867097-65867119 CCTTCTGATGTGAATTTACCTGG - Intergenic
1145878468 17:28336985-28337007 GCTTCTGGGTTGCACTTACAAGG + Intronic
1148944741 17:51250698-51250720 CCTTCTGGTATGAACTTCTGTGG + Intronic
1154148216 18:11884464-11884486 CTTTCTGGTTTGAACTTGCTCGG - Exonic
1160301621 18:77686839-77686861 GCTTCAGATCTGAACTTCCATGG - Intergenic
1160486320 18:79296304-79296326 CCTTCTGGGCTGCAGTAACATGG - Intronic
1162856516 19:13472670-13472692 CCTTCAGGTCTTCACTTACGTGG + Intronic
1163423795 19:17229753-17229775 GCTTCTGGTCTGCTGTTACATGG - Intergenic
925691228 2:6525460-6525482 CATTCTGGTCAGAAATGACAAGG - Intergenic
927088009 2:19690058-19690080 CCTTCTGGGCTGAGCTTATGTGG - Intergenic
928305048 2:30162628-30162650 CCTTCTGGTTTCAAGTTACTTGG - Intergenic
928734193 2:34266750-34266772 CCTTGTGGTCTTAACCTAGAAGG + Intergenic
929573315 2:43036990-43037012 CCATCTGGTCTGATCTTCCCAGG + Intergenic
930033479 2:47071964-47071986 CCTCCTGGGCAGAACTCACAGGG + Intronic
930998310 2:57749521-57749543 CCTTCTGATCTGGCCTTTCATGG + Intergenic
933612457 2:84451302-84451324 CCTTCTGGTCTGAAAACATATGG - Intronic
933619986 2:84527711-84527733 CCTTCAGCTCTGAACTTGCTAGG + Intronic
934086784 2:88516526-88516548 CCTTCAGTGCTGGACTTACATGG - Intergenic
935262920 2:101370619-101370641 CCTTCGGATCTGCACTTTCAAGG - Intronic
938073310 2:128319310-128319332 CCTACTGGGCTGCACTTCCAGGG + Intergenic
939169983 2:138684680-138684702 CCTTCTGGTCTGGACTTGGATGG - Intronic
942229121 2:173843230-173843252 CCTTCTGGTCTGTAACTTCAAGG - Intergenic
944913632 2:204334956-204334978 TCTTCTGGTATGAGCTGACATGG + Intergenic
946101818 2:217331855-217331877 CCCTCTGGTATGACCTTAGAGGG - Intronic
1173081828 20:39875795-39875817 ACTTCATGTCTGAGCTTACAGGG - Intergenic
1174876381 20:54230862-54230884 TCTTCTGGTCTGAACACACCTGG - Intergenic
1177278815 21:18951760-18951782 CTCTCTCGTCAGAACTTACATGG + Intergenic
1178774322 21:35534819-35534841 CCATCTGGTGTGAAATTATAAGG + Intronic
1178802559 21:35809693-35809715 CCTTCTGGTCTCAAGTTACAAGG - Intronic
1183567892 22:38629588-38629610 CATTCTTGCCTGAGCTTACATGG + Intronic
952570823 3:34713440-34713462 CCTTCTGGTCTCAAATTAAATGG + Intergenic
960297823 3:115966088-115966110 CCTATTGGTCAGAATTTACATGG - Intronic
960583143 3:119297371-119297393 CATTCTGGGCTGATCTTCCAAGG - Intronic
961367653 3:126410755-126410777 GCTCCTGGTCTGATCCTACATGG + Intronic
963701641 3:148633518-148633540 CTTTTTGGTCTCCACTTACATGG - Intergenic
964756143 3:160092297-160092319 CCTTCTGGTTTTATCTAACAGGG + Intergenic
965473063 3:169119299-169119321 TCTTTTGTTCTGAAATTACATGG + Intronic
968315309 3:197719149-197719171 CATTCTGTACTGATCTTACAAGG + Intronic
970040019 4:11786044-11786066 CCTTCCAGACTGGACTTACATGG + Intergenic
972292700 4:37704717-37704739 GCTTCTGGTAAGAACTTAGAAGG - Intergenic
974001210 4:56512496-56512518 CCTTCAGGTATTAGCTTACATGG + Intronic
975451523 4:74532671-74532693 CCTTCTGGTCCTCACTTAAATGG - Intergenic
977706900 4:100081614-100081636 CCTTCAAGTCTCAACTTAAATGG - Intergenic
986017158 5:3767406-3767428 CCTTCGCCTCTGAACTTTCATGG - Intergenic
991028763 5:62060132-62060154 CCTTCACGTTTGAACTTGCATGG + Intergenic
992866582 5:80962009-80962031 CTGTCTGATCTGAACTCACATGG - Intronic
993155482 5:84216982-84217004 CCTTCAGGTCTGAACTTCAGGGG - Intronic
993754004 5:91704728-91704750 TCTTCAAGTCTCAACTTACATGG - Intergenic
994157604 5:96521343-96521365 CCTTCTGGCCTCACCTTACCAGG + Intergenic
994510191 5:100693037-100693059 CCTTCTTCTAAGAACTTACAAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000780799 5:165478381-165478403 CCTTGTGCTCTTAAATTACAGGG - Intergenic
1005392873 6:25350963-25350985 ACTTCTGGGATGAAATTACAGGG - Intronic
1006021817 6:31121764-31121786 CCTGCTGGTCTGAACTTAAAGGG - Intronic
1008035967 6:46745467-46745489 CTTTCTTGTCTGGACTTCCACGG + Intergenic
1014999944 6:128202351-128202373 CCTAGTAGCCTGAACTTACAAGG - Intronic
1016158642 6:140846761-140846783 TCTTCTTGTCTGAGGTTACATGG + Intergenic
1020417889 7:7967703-7967725 CTTTCTCGTCTGAACACACAAGG + Intronic
1026254115 7:68696035-68696057 CCTTCTGCTATGATCTTCCAAGG - Intergenic
1026885633 7:73942190-73942212 CATTCTGAGCTGATCTTACAGGG + Intergenic
1029444215 7:100603819-100603841 CCCTCTGCTCTGCACTCACATGG + Intronic
1033647646 7:143317543-143317565 CAGTCTGGTCAGAACTTAAAAGG + Intronic
1042117873 8:65451989-65452011 CTTGCTGGTCTCAACTTACCTGG + Intergenic
1043653529 8:82631430-82631452 CCATCTAATGTGAACTTACAGGG - Intergenic
1043973680 8:86561912-86561934 CTTTCAGGTCTTAGCTTACATGG - Intronic
1046247891 8:111590653-111590675 CATCCTGGTTTGATCTTACAGGG - Intergenic
1050155774 9:2664950-2664972 CCTTCTGGCCTTTACTTACCCGG + Intergenic
1050458305 9:5854984-5855006 ACTGCTGGTCTGAACTCTCATGG - Intergenic
1050471636 9:5997837-5997859 CTGTCTGCTCTGAGCTTACATGG + Intronic
1052633239 9:31067877-31067899 TCTTTTGGTTTTAACTTACAAGG - Intergenic
1053419057 9:37965357-37965379 ACCTCTGGTCTCAACTTCCAGGG - Intronic
1053484196 9:38439646-38439668 CCTTGTGGTCTGGAATTAGAGGG + Intergenic
1061164934 9:128916769-128916791 CCATCTGGGCTGAACTTTCTTGG - Exonic
1190814114 X:53913502-53913524 CCTTCTGCTATGTCCTTACATGG - Intergenic
1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG + Intergenic
1194816522 X:98448224-98448246 CATTCTGGCCAGAATTTACATGG + Intergenic
1197371282 X:125628634-125628656 CCTTCAAGCCTGAACTTAGAGGG - Intergenic
1197900520 X:131366974-131366996 CCTTCTGGTCAGAACCTCCCTGG - Intronic
1199712316 X:150478059-150478081 CCTTTTGGTTTGAACTTCCAAGG + Intronic
1201850228 Y:18472281-18472303 CTTCCTGGTCTGAAGATACATGG + Intergenic
1201883090 Y:18848096-18848118 CTTCCTGGTCTGAAGATACATGG - Intergenic