ID: 1104444735

View in Genome Browser
Species Human (GRCh38)
Location 12:128823936-128823958
Sequence AGCTGGCGGCGTCGCATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104444735_1104444740 -5 Left 1104444735 12:128823936-128823958 CCCTCCATGCGACGCCGCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104444740 12:128823954-128823976 CAGCTGCCTCGCCCCGCCGCCGG 0: 1
1: 0
2: 0
3: 29
4: 293
1104444735_1104444741 -4 Left 1104444735 12:128823936-128823958 CCCTCCATGCGACGCCGCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104444741 12:128823955-128823977 AGCTGCCTCGCCCCGCCGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 268
1104444735_1104444749 18 Left 1104444735 12:128823936-128823958 CCCTCCATGCGACGCCGCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104444749 12:128823977-128823999 GTCACCTGTCCCAGAACCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 236
1104444735_1104444748 17 Left 1104444735 12:128823936-128823958 CCCTCCATGCGACGCCGCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104444748 12:128823976-128823998 GGTCACCTGTCCCAGAACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104444735 Original CRISPR AGCTGGCGGCGTCGCATGGA GGG (reversed) Exonic
900228554 1:1544284-1544306 AGCTGGCGGTGGAGCAGGGAGGG - Intronic
900899008 1:5504221-5504243 ACCTGGCCTCCTCGCATGGAGGG + Intergenic
902804003 1:18849549-18849571 AGCTGGCGGGGTCAGAGGGAAGG + Exonic
903332531 1:22603262-22603284 AGCTGGCCGCGGCACCTGGATGG - Exonic
904032246 1:27540499-27540521 AGTTGGTGGCGTGGCAAGGAGGG + Intronic
912432235 1:109634861-109634883 AGGTGGCGGGCTGGCATGGAAGG - Intergenic
912682681 1:111739153-111739175 AGCTGGCGCCGGGGCAGGGAGGG - Intronic
1076183671 10:128430463-128430485 TGCTGCTGGCGTCGCGTGGATGG + Intergenic
1083237707 11:61362199-61362221 AGCTAGCGGCGACGCTGGGAGGG + Exonic
1086341790 11:85855000-85855022 ATCTGGTGGCGACGCAGGGAAGG - Intergenic
1088311707 11:108467286-108467308 AGCTGGAGGCCTCGCTGGGAGGG + Intronic
1088810418 11:113388049-113388071 ACCTGGCGGCGTCGGGTGGAAGG - Exonic
1104444735 12:128823936-128823958 AGCTGGCGGCGTCGCATGGAGGG - Exonic
1104891994 12:132144610-132144632 GCCTGGCGGCGTCGCAGGGCCGG + Intronic
1105472027 13:20703594-20703616 CGCTGGCGGCGGAGCAGGGATGG + Intronic
1111672602 13:91348484-91348506 AGCGGGCGGCGTGGCGTGGGCGG + Intergenic
1113894467 13:113754932-113754954 AGCGGGAGGTGTCGCAGGGAGGG - Intergenic
1136408995 16:30065667-30065689 AGCGGGCGGCGTCCAATGGCAGG - Intronic
1136713287 16:32257608-32257630 AGCTGGCGCTGTCGCTTTGAGGG - Intergenic
1136754624 16:32671819-32671841 AGCTGGCGCTGTCGCTTTGAGGG + Intergenic
1136813488 16:33198545-33198567 AGCTGGCGCTGTCGCTTTGAGGG - Intronic
1136819964 16:33308625-33308647 AGCTGGCGCTGTCGCTTTGAGGG - Intergenic
1136826528 16:33365165-33365187 AGCTGGCGCTGTCGCTTTGAGGG - Intergenic
1136831594 16:33463936-33463958 AGCTGGCGCTGTCGCTTTGAGGG - Intergenic
1137028724 16:35502650-35502672 AGCTGGCGCTGTCGCTTTGAGGG + Intergenic
1137578823 16:49621258-49621280 AGCTGGGGGAGTCCCAGGGAAGG + Intronic
1202992065 16_KI270728v1_random:21520-21542 AGCTGGCGCTGTCGCTTTGAGGG - Intergenic
1203056771 16_KI270728v1_random:932154-932176 AGCTGGCGCTGTCGCTTTGAGGG + Intergenic
1143711154 17:8736172-8736194 AGCTTGGGGGGTGGCATGGAGGG + Intronic
1144327119 17:14193203-14193225 AGCCGGCGGCGCTGCCTGGATGG + Intronic
1144476006 17:15590066-15590088 AGCCGGCGGCGCTGCCTGGATGG + Intronic
1144527000 17:15999213-15999235 AGCTGGCCGGGTCGCTGGGAGGG - Intronic
1147156727 17:38547829-38547851 AGCTGGCGGCGGGGCGTGGGGGG + Intronic
1147843449 17:43388744-43388766 AGAGGGAGGCGGCGCATGGACGG + Intergenic
1152499539 17:80698556-80698578 AGCTGCCGGCCTAGGATGGAAGG - Intronic
1160791395 19:925351-925373 GGCGGGCGGCGTCGGAGGGAGGG - Intergenic
1168599272 19:57705127-57705149 AGCTGGGGGCCTGGCATGGAAGG + Intronic
945891790 2:215437206-215437228 ATCTGGCGGCGGGGGATGGAGGG - Intergenic
946895443 2:224319156-224319178 AGCTGGCAGCCTGGCAGGGAAGG - Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1180599536 22:17007361-17007383 AGCAGGCGTGGTGGCATGGAAGG + Intronic
1184418080 22:44363679-44363701 GGTTGGCGGCGGCGCCTGGACGG + Intergenic
1185402292 22:50625414-50625436 AGCTGGAGGCGTGGCAGGCAGGG + Exonic
953446403 3:42972317-42972339 AGCTGGGCCCGTGGCATGGAGGG - Intronic
953730755 3:45445518-45445540 AGCAGGCTGCGTCGTATGCATGG + Intronic
955744614 3:62127637-62127659 AGCTGGCGGTGTCGGATTCAAGG + Intronic
967012352 3:185447876-185447898 TGCTGGCACGGTCGCATGGATGG + Exonic
985733614 5:1565095-1565117 AGAGGGCGGCGCTGCATGGAGGG - Intergenic
991490693 5:67180140-67180162 AGCAAGCTGCATCGCATGGAAGG + Intergenic
1018304732 6:162443269-162443291 AGCTGGCGGCATCCCAAGAACGG + Intronic
1019452882 7:1108601-1108623 AGCTGGCGGAGACACATGGCAGG - Intronic
1022734352 7:33062443-33062465 AGCTGCCGGCGTCGCCTGTCAGG - Intronic
1032078785 7:128848515-128848537 AGTTGGCTGGGTGGCATGGACGG - Intronic
1038056376 8:23862057-23862079 AGCTGGTGGCTTCGCATTCACGG - Intergenic
1062266321 9:135688040-135688062 AGCTGGCGGCCTCCCAGGGAAGG + Intergenic
1192501707 X:71658354-71658376 AGATGGGGGCGCGGCATGGAGGG + Intergenic
1192511872 X:71725475-71725497 AGATGGGGGCGCGGCATGGAGGG - Intergenic
1192514825 X:71756030-71756052 AGATGGGGGCGCGGCATGGAGGG + Intergenic