ID: 1104445373

View in Genome Browser
Species Human (GRCh38)
Location 12:128828821-128828843
Sequence CAGGTTCTCCTGAGCTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104445373 Original CRISPR CAGGTTCTCCTGAGCTACAT GGG (reversed) Intergenic
902729320 1:18358481-18358503 CAGGTGCTCCCCAGCCACATGGG + Intronic
904540622 1:31230473-31230495 CAGGTTTTCCTGATTTACATTGG - Intronic
906776010 1:48530169-48530191 CAGGTTCTCACTAGCCACATGGG + Intergenic
909202235 1:72705060-72705082 CAGGTTCTTCTGACCTGCAGGGG + Intergenic
911168280 1:94744628-94744650 CTGGTTCTCCTGAGCCAGAATGG - Intergenic
913138211 1:115913302-115913324 CAGATTCTCCTGAGGCACATGGG - Intergenic
917716966 1:177748077-177748099 CAGGTTTTCCTAGGCTACTTGGG - Intergenic
919797418 1:201329623-201329645 CAGGGTCTCCTGAGCTAAGGGGG + Intronic
922510125 1:226158759-226158781 CTGGTTCTGCAGAGCTAGATTGG - Intronic
1066603207 10:37131539-37131561 CAGGCACTCCTGTTCTACATGGG - Intronic
1067221303 10:44346125-44346147 CAGTTTCTCCTCAGCTAGAAAGG + Intergenic
1069268927 10:66499525-66499547 AAGGTTAGCCTGAGCTACATAGG - Intronic
1071735098 10:88289793-88289815 GAGCTTCTCCTCAGCTATATGGG - Intronic
1074528920 10:114283480-114283502 CAGATTCTCCTGTGCTTCAGAGG - Intronic
1077830080 11:5857864-5857886 TAGCCTCTCCTGAGCAACATTGG + Intronic
1085915774 11:80885943-80885965 GAGGTTCTCCTGAGCCAGAGAGG - Intergenic
1086107048 11:83157561-83157583 CAGGTTCTCCTCGGCTAGAATGG - Exonic
1090703064 11:129313699-129313721 CAATTTTTCCTGAGCTACAGTGG + Intergenic
1091922756 12:4319098-4319120 CAGATTCTCCTGACCTGCCTTGG + Intergenic
1098154941 12:67588233-67588255 CAGCTTCTCCTGAGGTTCATGGG - Intergenic
1100174343 12:92012359-92012381 AAGGATCACCTGAGCTACAGAGG + Intronic
1102236213 12:111296196-111296218 CTGGGTCCCCTGAGCTACCTAGG + Intronic
1102612756 12:114127178-114127200 AAGGTCCTCATCAGCTACATGGG + Intergenic
1103056892 12:117828627-117828649 CAGGCTGTCCTGAGTTACAAGGG + Intronic
1104445373 12:128828821-128828843 CAGGTTCTCCTGAGCTACATGGG - Intergenic
1105883974 13:24626935-24626957 CAGGTTCTCCTTAGCAAAGTGGG + Intergenic
1107834972 13:44405711-44405733 GAGGTTCTCCTGAGCTACCTGGG + Intergenic
1112864066 13:103872105-103872127 CAGGTACTTCTGAGATACAATGG + Intergenic
1114780966 14:25537691-25537713 CATGGACTCCTGGGCTACATTGG - Intergenic
1118056381 14:62083521-62083543 CAGGTTCTCCTGGGCTCACTTGG + Intronic
1118447655 14:65866418-65866440 CAGATACTCCTGAGCCTCATGGG - Intergenic
1121248151 14:92478727-92478749 CAGTTTCTGCTCAGCTACCTGGG + Intronic
1122348337 14:101073859-101073881 CAGCTTCTCCTGAGCTCCTTTGG + Intergenic
1123216024 14:106810067-106810089 CAGGTCCTCCTGGGCTTCCTCGG + Intergenic
1123391639 15:19880490-19880512 CAGGCTCTCCTGCTCTAAATGGG - Intergenic
1127901830 15:63346538-63346560 CAGTTTCTCCTGACCAACAATGG - Exonic
1137395285 16:48112745-48112767 CTGCTTCTCCTGGGCTAAATGGG - Intronic
1137529617 16:49270192-49270214 CAGCTTCTCCTGAGCTCCTGAGG + Intergenic
1137691804 16:50433449-50433471 CACTTTCCCCTGAGCTGCATGGG + Intergenic
1138128914 16:54462040-54462062 CATGATCTCATGAGGTACATGGG + Intergenic
1139936943 16:70578356-70578378 CAGGTTTTCCTGAGGGACACAGG - Intergenic
1141102916 16:81211124-81211146 CAGGTTCTCCTGACCCTCACAGG + Intergenic
1147165536 17:38591284-38591306 CAGGTTCCCCTGAGGGCCATGGG - Intronic
1147530475 17:41271647-41271669 CAGGTTCTCCTGCAGTAGATGGG - Intergenic
1147530889 17:41276019-41276041 CAGGTTCTCCTGCAGTAGATGGG - Exonic
1148340093 17:46868132-46868154 CAGGTGCTCCTGAGCCTCCTGGG - Intronic
1149773265 17:59338084-59338106 CTGGGTCTCCTGAGCTACAGAGG + Intronic
1156523860 18:37747646-37747668 CAGGTTCTCCTGGGATGCAAGGG - Intergenic
1157497062 18:48163528-48163550 CTGGTCTTCCTGAGCTACTTTGG - Intronic
1157754020 18:50202526-50202548 CAGATCATCCTGAGCAACATAGG + Intergenic
1160997171 19:1888150-1888172 GAGGTTCTCCTGAGGTCCAAAGG + Intergenic
1162620268 19:11837556-11837578 CAAGGTCTCCTTAGCTACACAGG - Intergenic
926341188 2:11906104-11906126 CAGGTTTCCCTGAGCTACACTGG - Intergenic
927429405 2:23014252-23014274 GAGGTCCTTCTGAGCTCCATGGG + Intergenic
929429960 2:41878588-41878610 CAGGTTCTCCTCACCTACTCAGG + Intergenic
932349997 2:71023985-71024007 CAGTGACTCCTGACCTACATGGG - Intergenic
936289445 2:111208917-111208939 CAGGTTCTTCTGAGCTATGAAGG - Intergenic
936634048 2:114235172-114235194 CAGCTTTTCCTGAGCTACACTGG - Intergenic
937871347 2:126788376-126788398 CAGCTTCTGCAGAGCTGCATTGG + Intergenic
940869573 2:158848758-158848780 CAGTGACTCCTGATCTACATGGG - Intronic
942122461 2:172791977-172791999 CAGATTCTACTTAGCTACATAGG - Intronic
1169590807 20:7140071-7140093 GATGTTCACCAGAGCTACATAGG - Intergenic
1170327535 20:15173335-15173357 CAGCTTCTCTTTAACTACATAGG - Intronic
1173965750 20:47111394-47111416 GAGGTTCTACTGAGCTAGACTGG + Intronic
1178002665 21:28181516-28181538 CAGGTCCTCCTTTGATACATGGG - Intergenic
1178091372 21:29167161-29167183 CAGGTTCTCCTGTGCTTCATTGG + Intronic
1178336989 21:31752176-31752198 TTGGTTCCCCTGGGCTACATGGG - Intergenic
1180920635 22:19519818-19519840 CAGGGTGGCCTGGGCTACATGGG + Intronic
1185110080 22:48895951-48895973 CAGGTGCACCTGCGCCACATGGG + Intergenic
1185142368 22:49109641-49109663 CAGGTGCTCCGGGGCTACAGGGG - Intergenic
1185233942 22:49700201-49700223 CAGTCTCTCCTGAGCCCCATGGG + Intergenic
949241767 3:1881199-1881221 CAGGACCTCCTGAGGTCCATGGG - Intergenic
949268587 3:2188437-2188459 CAAGTTCTCCTGAGGAAGATTGG + Intronic
949519962 3:4842320-4842342 CTGTTTATCCTTAGCTACATGGG + Intronic
950357644 3:12425326-12425348 CAGGTTTTTCTGAGAGACATTGG + Intronic
951481934 3:23170340-23170362 GAGCTTCTCATGAACTACATGGG + Intergenic
951853730 3:27171128-27171150 CAAGTTCTCCTGACCTTCACTGG - Intronic
953663522 3:44908182-44908204 CAGTTTGTCCTGAGCTGCCTTGG - Intronic
956614872 3:71160654-71160676 CAGGTGCTCCATAGCTACATTGG + Intronic
957076134 3:75604522-75604544 CAGTGACTCCTGACCTACATGGG + Intergenic
959267640 3:104163613-104163635 CAGGTTATGCTGTGCTTCATTGG + Intergenic
961030884 3:123602624-123602646 CATGTAGTCCTGAGCTACTTGGG + Intergenic
962703042 3:138017867-138017889 CAGGTTCTCTTGAGCTGTGTAGG - Intronic
962926639 3:139999594-139999616 CAGGTTTTCCTGATAGACATGGG + Intronic
962987039 3:140545393-140545415 CAGGTTCTCCTGGGCTCTCTTGG - Intronic
965344574 3:167532713-167532735 AAGGTTCTCTTTAGCTACTTTGG + Intronic
968763027 4:2452054-2452076 CAGGTTTTCCTGAGGGACAGTGG - Intronic
970991288 4:22216208-22216230 CAGGTTATCCTGGGCGGCATTGG - Intergenic
972380721 4:38517587-38517609 CAGGTTCCCCTGATCTGCCTGGG + Intergenic
975103505 4:70541510-70541532 CAGTTTCTCCTACGCTACCTAGG + Intergenic
976231644 4:82850041-82850063 CAGGGTCTACTGAGATAAATAGG + Intronic
983994358 4:174163183-174163205 CAGCTTCACCAGAACTACATAGG - Intergenic
988632898 5:32950212-32950234 CAAGCTCTACTGAGCTTCATGGG - Intergenic
991363274 5:65842931-65842953 GAGGTTCTCCTAAGCTCCATAGG + Intronic
994519047 5:100806527-100806549 CAGGTTATTCTTAGCTACTTTGG - Intergenic
997525029 5:134547354-134547376 CAAGTTCTGCTGAGCTGCTTAGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003269467 6:4594538-4594560 CTGGTTCACCTCAGCTGCATTGG - Intergenic
1005116181 6:22340089-22340111 CAAATTGTCCAGAGCTACATGGG - Intergenic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1008940596 6:57041396-57041418 CAAGTTCCCCTGAGCTCCAGTGG - Intergenic
1009294404 6:61927040-61927062 CAGTTTCTTCTGAGTGACATAGG - Intronic
1010735632 6:79441050-79441072 CAGTATCTCTTGATCTACATTGG + Intergenic
1016376875 6:143430290-143430312 CTGGTTCTCCTGAGCAGCAATGG - Intronic
1023978803 7:45053791-45053813 CATGTTCTCCTGAGGGACATGGG + Intronic
1028822101 7:95224200-95224222 CAGGTACTCAGGAGATACATAGG + Intronic
1029232619 7:99083742-99083764 CAGTTTCTCTTGATCTACTTTGG + Intronic
1030376960 7:108763272-108763294 CAGGATCTTCTGAGGTACTTTGG + Intergenic
1030485349 7:110159220-110159242 TTGGTTCCCCTGAGCCACATTGG - Intergenic
1032281465 7:130506037-130506059 CAGGAATTACTGAGCTACATTGG - Exonic
1033952004 7:146796472-146796494 CAGCTTCTCCTGGGGTACTTTGG + Intronic
1034237631 7:149585110-149585132 CAGGTTCTCCTGTGCCACAGTGG - Intergenic
1034240713 7:149608764-149608786 CAGGTTCTCCTGTGCCACAGTGG - Intergenic
1034378102 7:150664499-150664521 CAGGTTGTGCTGAGAGACATGGG - Intergenic
1035870604 8:3133141-3133163 CAGCTTCTCCTCAGCGACCTGGG + Intronic
1045733251 8:105266320-105266342 CTGGCTCCCCTGAGCCACATTGG - Intronic
1046759766 8:118009181-118009203 AAGGGTCCCCTGAGCTACACTGG + Intronic
1052188588 9:25629354-25629376 CACATTTTCCTGAGCTAAATGGG - Intergenic
1053346702 9:37383472-37383494 CTGGTTATCCAGAGCTACCTAGG + Intergenic
1055215043 9:73849298-73849320 CTGGTTCTCTTGTGCTACAGAGG + Intergenic
1056865900 9:90227219-90227241 CAGTGACTCCTGACCTACATGGG - Intergenic
1056917120 9:90755687-90755709 CAGTGACTCCTGACCTACATGGG + Intergenic
1057704093 9:97385703-97385725 CATGTTCTCCTGGGCTTCAAGGG + Intergenic
1060726196 9:126007439-126007461 CAGGTTCTCCTGAACTATGTGGG - Intergenic
1192488722 X:71554296-71554318 CATGTTCTCATGAGCAAAATGGG - Intronic
1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG + Intergenic