ID: 1104455665

View in Genome Browser
Species Human (GRCh38)
Location 12:128909879-128909901
Sequence TGCAAGGCAGGCCGTACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104455662_1104455665 3 Left 1104455662 12:128909853-128909875 CCATTGTGTGCACTGATGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 94
Right 1104455665 12:128909879-128909901 TGCAAGGCAGGCCGTACACAAGG 0: 1
1: 0
2: 0
3: 7
4: 157
1104455661_1104455665 15 Left 1104455661 12:128909841-128909863 CCTCAGTGTTTGCCATTGTGTGC 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1104455665 12:128909879-128909901 TGCAAGGCAGGCCGTACACAAGG 0: 1
1: 0
2: 0
3: 7
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104455665 Original CRISPR TGCAAGGCAGGCCGTACACA AGG Intronic
901046834 1:6401746-6401768 GTCAAGGCAGGCGGAACACAAGG - Intergenic
908476224 1:64491434-64491456 AGCAAGGCATGCCTTATACATGG + Intronic
909582492 1:77253673-77253695 TGAAAGGCAGGCAGGCCACAAGG + Intergenic
912504028 1:110143342-110143364 TGCAAGCCAGGCTGTCCAGAAGG - Intergenic
912830513 1:112949088-112949110 TGCGAGGCAGGCGGATCACAAGG - Intronic
913199558 1:116484872-116484894 TGCTAGGCAGGCGTTGCACATGG + Intergenic
917432798 1:174988041-174988063 TCCAAGGCAGGCAGATCACAAGG - Intronic
921029582 1:211325942-211325964 GGCAAGGCAGGCGGATCACAAGG + Intergenic
921312228 1:213855791-213855813 TGCAAGGCAGACCACACAGAAGG - Intergenic
921763779 1:218946643-218946665 TGCAATGCATGCCGTAGACCAGG - Intergenic
924401806 1:243691369-243691391 TCCAAGGCAGGGCTTTCACAGGG + Intronic
1064335250 10:14434669-14434691 TGGAAGGCAGTCCGTTCACTGGG + Intronic
1064367309 10:14719594-14719616 TGGCAGGAAGGCCGTACGCAAGG - Intronic
1064432062 10:15279683-15279705 TCCAAGGCAGGCGGATCACAAGG + Intronic
1066534666 10:36378584-36378606 GCCAAGGCAGGCTGAACACAAGG - Intergenic
1069870214 10:71528476-71528498 TGCAAGGCCAGCCGTGCAGAAGG - Intronic
1072316267 10:94206260-94206282 TGCCAGGCACGCTTTACACAGGG - Intronic
1073185145 10:101611356-101611378 TGAGACGCAGGCAGTACACAGGG + Exonic
1073628312 10:105121893-105121915 TGCATGGCAAGACGTACACAGGG - Intronic
1073820183 10:107253035-107253057 GCCAAGGCAGGCAGAACACAAGG - Intergenic
1073975106 10:109091699-109091721 TCCAAGGCAGGCAGATCACAAGG + Intergenic
1076380110 10:130019140-130019162 TGCAAGGCAGACAGGCCACAGGG + Intergenic
1076991289 11:277198-277220 TCCAAGGCAGGCAGATCACAAGG + Intergenic
1077061851 11:621020-621042 TTCTAGGCAGGCTGGACACAGGG - Intronic
1077301416 11:1848885-1848907 TGCCAGGCGGGCAGGACACAGGG - Intergenic
1078038132 11:7829828-7829850 TGAAAGGCAGACCATACAGAGGG + Intergenic
1081743106 11:45454632-45454654 TGCAAGCAAGGCCCTTCACACGG + Intergenic
1081926107 11:46830205-46830227 TCCAAGGCAGGCAGATCACAAGG + Intronic
1082765628 11:57165345-57165367 TGCATGGCAGGCGGTGCAGAGGG - Intergenic
1083298285 11:61726953-61726975 TGCAAGGCAGGCCATGCAGAGGG + Intronic
1083372714 11:62194402-62194424 TGCAAGGCAGGCAGATCACAAGG + Intergenic
1083601957 11:63954314-63954336 TGCAAGGCAGGCAGGAGAAAAGG - Intronic
1084939710 11:72605987-72606009 GGCAGGGCAGGACGTGCACAGGG + Intronic
1089314656 11:117583301-117583323 TGCCAGGCAGGTCTTAAACATGG + Intronic
1091413156 12:257548-257570 TGGAAGGCAGGCTCTACCCAGGG + Intronic
1101382298 12:104224616-104224638 TCCAAGGCAGGCAGATCACAAGG - Intronic
1101925024 12:108964620-108964642 TCCATGACAGGCCTTACACAGGG - Intronic
1102130824 12:110527483-110527505 TGCAAGGCAAGCCTTGCAGAGGG + Intronic
1102481539 12:113227198-113227220 TGCAAGGCAGGCAGTGGAGAAGG - Intronic
1102670880 12:114617818-114617840 TCCAAGGCAGGCAGATCACAAGG - Intergenic
1104455665 12:128909879-128909901 TGCAAGGCAGGCCGTACACAAGG + Intronic
1112497126 13:99914052-99914074 TGCAGGCAAGGCAGTACACAGGG - Intergenic
1114456675 14:22859328-22859350 TCCAAGGCAGGCGGATCACAAGG + Intergenic
1117384339 14:55195595-55195617 TGAAAGGCAGTCTGAACACAAGG - Intergenic
1118041596 14:61922813-61922835 GCCAAGGCAGGCCGATCACAAGG + Intergenic
1119547335 14:75481885-75481907 TGTCAGGGAGGCGGTACACAGGG + Intergenic
1119567345 14:75640023-75640045 TCCAAGGCAGGCAGATCACAAGG + Intronic
1119918078 14:78421028-78421050 TACAAGGCAGGCAGATCACAAGG + Intronic
1121569281 14:94935366-94935388 TGCATGGCATGCAGTAAACATGG - Intergenic
1122375381 14:101253553-101253575 TGCAAGCCAGGCCCTGGACATGG + Intergenic
1122894306 14:104748500-104748522 TGGAAGGCAGGCGTTTCACAGGG + Intergenic
1123448458 15:20345732-20345754 TGCAGGGCAGGCCCTGCCCAAGG - Intergenic
1128083320 15:64869395-64869417 GGCAAGGCAGGCGGATCACAAGG - Intronic
1132339309 15:101068015-101068037 TGCCACGCAGGCCGCACACACGG + Intronic
1133979341 16:10622042-10622064 GGCAAGGCAGGCAGGACACTGGG - Intergenic
1135834687 16:25814577-25814599 GGCAAGGCAGGCGGATCACAAGG - Intronic
1140797439 16:78452709-78452731 GCCAAGGCAGGCCGATCACATGG - Intronic
1145391263 17:22457466-22457488 GCCAAGGCAGGCAGAACACAAGG - Intergenic
1148128554 17:45248895-45248917 TGCAAGGCAGGCCTTCTGCAGGG - Intergenic
1148292970 17:46472671-46472693 GGCAAGGCAGGCGGATCACAAGG + Intergenic
1148315154 17:46690368-46690390 GGCAAGGCAGGCGGATCACAAGG + Intronic
1149822881 17:59797097-59797119 AGCAAGGCAGGCGGGTCACAAGG + Intronic
1150269238 17:63852039-63852061 GCCGAGGCAGGCCGTTCACAAGG + Intergenic
1150421539 17:65040723-65040745 TCCAAGGCAGGCAGATCACAAGG - Intronic
1150577002 17:66439412-66439434 GGCAAGGCAGGCAGATCACAAGG - Intronic
1151131395 17:71900868-71900890 TGCAAGACAGGCTGTGCCCAGGG + Intergenic
1151161204 17:72167258-72167280 TGCAAGCCTGGCTGTACCCATGG - Intergenic
1151663592 17:75532825-75532847 TGCCAGGCATGACGTCCACAGGG + Intronic
1153097780 18:1427805-1427827 TGCAAAGCTGGCCCTGCACAGGG - Intergenic
1153320740 18:3771558-3771580 TGCAAGTCCCGCAGTACACACGG - Intronic
1153712865 18:7817959-7817981 CGCAAGGCAGATGGTACACAGGG + Intronic
1157401676 18:47393857-47393879 GGCAAGGCAGGCGGATCACAAGG + Intergenic
1160821582 19:1061460-1061482 TTCAAGGCAGGCGGATCACAAGG + Intronic
1165788198 19:38474941-38474963 TGCAAGGCAGGCGGAACCCTGGG - Intronic
1167463664 19:49639193-49639215 TCCAAGGCAGGCCGATCACGAGG + Intronic
1167789353 19:51663450-51663472 TTCAAGGCAGGCGGATCACAAGG - Intergenic
925804014 2:7630729-7630751 GCCAAGGCAGGCCGATCACAAGG + Intergenic
926222122 2:10943187-10943209 GCCAAGGCAGGCAGGACACAAGG - Intergenic
927728671 2:25449994-25450016 TTCAAGGCAGGCGGGTCACAAGG - Intronic
936077622 2:109411713-109411735 TGCTAGGAAGGCCGGCCACACGG + Intronic
937048630 2:118869434-118869456 TGAAAGGCAGGCCATAGACCAGG - Intergenic
938379836 2:130830310-130830332 TCCAAGGCAGGCGGATCACAAGG + Intergenic
941605079 2:167586531-167586553 GGCAAGGCAGGCGGATCACAAGG - Intergenic
942555498 2:177168657-177168679 TCCAAGGCAGGCAGATCACAAGG + Intergenic
945070157 2:205981353-205981375 TCCAAGGCAGGCGGATCACAAGG + Intergenic
946260643 2:218487651-218487673 GCCAAGGCAGGCGGTTCACAAGG - Intronic
947330805 2:229027522-229027544 TGTAAGGCAGGCCGTGGAAAGGG + Intronic
947936820 2:234012378-234012400 TCCAAGGCAGGCAGATCACAAGG - Intronic
947991207 2:234489017-234489039 TGCAAGGCAAGTCACACACACGG - Intergenic
948289270 2:236813085-236813107 TGCAAGGCAAGGCGCCCACAGGG - Intergenic
1171049255 20:21840214-21840236 TGCAAGGCAGGCTGCACGCTTGG + Intergenic
1172339954 20:34149234-34149256 GCCAAGGCAGGCGGTTCACAAGG - Intergenic
1172484372 20:35289569-35289591 TCCAAGGCAGGCAGATCACAAGG - Intronic
1173528829 20:43752893-43752915 TCCAAGGCAGGCGGTAGACGTGG - Intergenic
1174059938 20:47825767-47825789 TGGCAGGCAGGCAGTATACATGG + Intergenic
1174243471 20:49157710-49157732 TCCAAGGCGGGCAGTTCACAAGG - Intronic
1176979153 21:15359441-15359463 TGCAAGGCCTGCCGGCCACACGG - Intergenic
1179639078 21:42735353-42735375 TGCAAGGCAGGCCCCACGAAGGG + Intronic
1181259082 22:21584407-21584429 GCCAAGGCAGGCAGAACACAAGG - Intronic
1181491703 22:23264272-23264294 TGAGATGCAGGCAGTACACAGGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184274408 22:43401933-43401955 TGCAAGGCTGGCAGTCCCCAGGG + Intergenic
950616698 3:14165616-14165638 TGGAAGGAAGGCCGGACACCAGG + Intronic
953661072 3:44892022-44892044 GCCAAGGCAGGCGGAACACAGGG + Intronic
954598045 3:51844084-51844106 GGCAAGGCAGGCGGATCACAAGG + Intergenic
960150126 3:114240838-114240860 GCCAAGGCAGGCGGTTCACAAGG + Intergenic
964362768 3:155915632-155915654 GGCAAGGCAGGCAGATCACAAGG - Intronic
964711074 3:159672384-159672406 TGCAAGGCAGTCTCTTCACATGG + Intronic
966187973 3:177245246-177245268 GCCAAGGCAGGCGGTTCACAAGG - Intergenic
968312570 3:197696137-197696159 GGCAAGGCAGGCGGATCACAAGG + Intronic
971337475 4:25737215-25737237 GCCAAGGCAGGCAGTTCACAAGG - Intergenic
973054825 4:45642489-45642511 TCCAAGGCAGGCAGATCACAAGG - Intergenic
973848599 4:54938278-54938300 TGAAAAGCAGGCCCTACAGACGG - Intergenic
980517342 4:133879697-133879719 AGCAAGGCATGCTGAACACAGGG + Intergenic
981310602 4:143294488-143294510 TCCAAGGCAAGCCAAACACAGGG + Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
982922598 4:161294166-161294188 GCCAAGGCAGGCCGATCACAAGG + Intergenic
984223355 4:177004968-177004990 GCCAAGGCAGGCGGAACACAAGG - Intergenic
986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG + Intergenic
990503643 5:56423127-56423149 GGCAAGGCAGCCAGTATACAGGG - Intergenic
992448775 5:76857057-76857079 GCCAAGGCAGGCAGAACACAAGG + Intronic
992842301 5:80708077-80708099 TAAAAGGCAGGCCATACACTGGG - Intronic
993919883 5:93788394-93788416 TGCAGTGCAGGCCTTCCACAGGG + Intronic
994092055 5:95818271-95818293 TGAATGGCAGGCTGTACAGACGG + Intronic
996394963 5:123004539-123004561 TGGTAGGCAGGCCACACACAAGG - Intronic
996540779 5:124628767-124628789 TGGAAAGCAGGAGGTACACAGGG + Intergenic
998011427 5:138698554-138698576 TCCAAGGCAGGCGGATCACAAGG - Intronic
998671101 5:144355148-144355170 TGGAGGGCAAGCCGTAAACATGG - Intronic
1000130104 5:158288967-158288989 TGCAAGGCAGGCCGGGGAAAGGG - Intergenic
1002105612 5:176878178-176878200 CCCAAGGCAGGCAGTCCACAGGG - Intronic
1006564287 6:34941218-34941240 GCCAAGGCAGGCCGATCACAAGG - Intronic
1018436321 6:163762425-163762447 ACCAAGGCAGGCCGATCACAAGG + Intergenic
1018796356 6:167188239-167188261 GCCAAGGCAGGCCGATCACAAGG + Intronic
1018819962 6:167366820-167366842 GCCAAGGCAGGCCGATCACAAGG - Intronic
1020727595 7:11834865-11834887 TTCATGGCAGGCTGTACAGATGG - Intergenic
1024968409 7:55046457-55046479 TGAAGGGCAGCCCATACACAAGG - Intronic
1025234971 7:57228235-57228257 TGGCAGGCAGGCAGTATACATGG - Intergenic
1026362654 7:69616948-69616970 TGCTAGGCAGGCAGTACTCCAGG + Intronic
1032325721 7:130926596-130926618 AGCAAGGCAGGCCGTGCATGAGG - Intergenic
1032332953 7:130997040-130997062 TGAAAGCAAGGCCGTACAGATGG - Intergenic
1032355219 7:131204729-131204751 GCCAAGGCAGGCCGATCACAAGG + Intronic
1033474072 7:141674096-141674118 TGGAAGGCAGCCAGTAGACAGGG + Exonic
1034823898 7:154242826-154242848 ACCATGGCAGGCAGTACACAGGG + Intronic
1035431541 7:158826928-158826950 GCCAAGGCAGGCGGAACACAAGG + Intronic
1037522833 8:19696988-19697010 TGCAAGGCAGGAGGTAAAGATGG + Intronic
1037753672 8:21698169-21698191 TGCAAGGATGGCAGGACACAAGG + Intronic
1039892626 8:41695369-41695391 TACAAGGCAGGCAGGGCACAGGG + Intronic
1041222675 8:55667366-55667388 TCCAAGGCAGGCAGATCACAAGG + Intergenic
1042695781 8:71554054-71554076 TGCCAGTGAGGCCGGACACAGGG + Intronic
1044464033 8:92482912-92482934 TGCAAGGCAGGCTGTAGCCTTGG + Intergenic
1046561044 8:115837692-115837714 AGCAAGGCAGGCGGATCACAAGG + Intergenic
1048433644 8:134394965-134394987 GCCAAGGCAGGCAGTTCACAAGG - Intergenic
1052931759 9:34061473-34061495 GCCAAGGCAGGCAGTTCACAAGG - Intergenic
1056328966 9:85505880-85505902 TGCAAGGCAGTCCGTGCCCTGGG - Intergenic
1058549941 9:106103892-106103914 TCCAAGGCAGCCTTTACACAAGG - Intergenic
1061724857 9:132576649-132576671 TGCTAGGCAGGCAGCAGACATGG - Intergenic
1061967429 9:134024024-134024046 TGCGAGGCAGGCGGATCACAAGG + Intergenic
1186286445 X:8048914-8048936 TGCAATGCAGAACGTAAACAGGG + Intergenic
1186530054 X:10286393-10286415 GGCAAGCCAGGCTGGACACATGG - Intergenic
1190185015 X:48225957-48225979 TGCAATTCAGGGCATACACACGG + Intronic
1191175792 X:57500333-57500355 TGAAAGACAGACAGTACACATGG - Intergenic
1192741328 X:73895755-73895777 TCCAAGGCGGGCAGTTCACAAGG + Intergenic
1193309630 X:79990521-79990543 TGGAAGGCAGGCAGATCACAGGG + Intergenic
1197484085 X:127025349-127025371 TTCAAGGCAGGCTGTGCACAAGG - Intergenic
1200774072 Y:7153900-7153922 TTCAAGGCAGGCAGATCACAAGG - Intergenic