ID: 1104457238

View in Genome Browser
Species Human (GRCh38)
Location 12:128924989-128925011
Sequence AAGAAGCAGCATTGTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104457238 Original CRISPR AAGAAGCAGCATTGTTTCCC AGG (reversed) Intronic
901206056 1:7496564-7496586 CAGATGCAGCAATGTTCCCCTGG + Intronic
903103867 1:21056974-21056996 AAGAAGCAAAAATGTTTCTCGGG - Intronic
903533988 1:24054370-24054392 AAGAAGCAACACTGTTGCACTGG + Intergenic
904381431 1:30113832-30113854 AAGAAGCATGATTCTTTCTCCGG + Intergenic
905537416 1:38733818-38733840 AAGTAGACGCATTGTTTGCCAGG - Intergenic
906704879 1:47887696-47887718 AGGAAGCAGGCTGGTTTCCCCGG - Intronic
906954207 1:50358964-50358986 AGTAAAAAGCATTGTTTCCCTGG - Intergenic
907576253 1:55528372-55528394 AAGAAGCAGGATTATTTCCTTGG - Intergenic
909033462 1:70569348-70569370 AAGAAGAAGCAGTGTGTACCTGG + Intergenic
909036274 1:70597438-70597460 ATGAACCAGCCTTGCTTCCCAGG + Intergenic
909674233 1:78221389-78221411 AAGAAGTAGCATTGTACCCAGGG + Intergenic
909873357 1:80773093-80773115 AAGATGCAGAAATGTTTACCAGG - Intergenic
910076513 1:83286151-83286173 AAGAAGCAGCATAGTTTGAGGGG + Intergenic
911648687 1:100362798-100362820 ATGAAGCAGCATTGTTGCCTGGG + Intronic
913060166 1:115197332-115197354 AAGAAGCAGCATTATTTAGGTGG - Intergenic
914684628 1:149967468-149967490 CAGCTCCAGCATTGTTTCCCTGG - Exonic
916369952 1:164080909-164080931 CATAAGCAGCATCTTTTCCCAGG + Intergenic
917397303 1:174607516-174607538 AAGATGCAGCATTGTGATCCTGG - Intronic
917465431 1:175271853-175271875 AAAAAGCAGCCTTGGGTCCCCGG + Intergenic
918134128 1:181655669-181655691 AAGAAGAGGAATTGATTCCCAGG + Intronic
918312834 1:183297879-183297901 AAAAAACAGCCTTGTATCCCTGG - Intronic
921221135 1:212974729-212974751 GAAAAGCAGTATTTTTTCCCAGG - Intronic
923486386 1:234435454-234435476 AATAAGCAGCTTTGTCACCCAGG - Intronic
923716275 1:236427191-236427213 GATAAGCAGCATTGTTTAGCTGG + Intronic
924426038 1:243951272-243951294 AAGAAGCAGAATTTGTTCCTGGG + Intergenic
924670150 1:246115611-246115633 AAAAAGCAGCATGGTTTCACTGG + Intronic
924759953 1:246974656-246974678 AAGGAGAAGCCTTGCTTCCCAGG + Intronic
1066216085 10:33288978-33289000 CAAAAACAGTATTGTTTCCCTGG + Intronic
1066340427 10:34527279-34527301 AAGAACTAGCCTTGTTTCCAAGG + Intronic
1066661929 10:37745337-37745359 AACAAGCAGCAAGGTTTCCAGGG - Intergenic
1069787407 10:70997742-70997764 CAGAAGCAGCATTTATACCCAGG + Intergenic
1071035599 10:81240332-81240354 AAGACTCAGCATCTTTTCCCTGG - Intergenic
1071313388 10:84366026-84366048 ATCAAGCAGCAATGTTTGCCAGG - Intronic
1072534332 10:96349709-96349731 AAGAAGCAGCATTGAGGCCATGG - Exonic
1072855816 10:98944922-98944944 AAGAGGCATAATGGTTTCCCCGG - Intronic
1073814295 10:107189027-107189049 AAGAAAAAACATTGTTTCACTGG - Intergenic
1074397190 10:113107831-113107853 AAGAAACACCATTATTTCACAGG - Intronic
1076052181 10:127344338-127344360 AAGAAGCACCATTGTTGCATGGG + Intronic
1077833349 11:5900155-5900177 AAGAGGGAGCATTGTTTTTCTGG + Intronic
1078682557 11:13491122-13491144 AAGAAGTAGGAGGGTTTCCCAGG - Intergenic
1079783688 11:24642925-24642947 AATTAGCAGGATTGTTGCCCTGG + Intronic
1080063153 11:27979551-27979573 GAGATGCAGCTTTGTTTCCAAGG - Intergenic
1080668315 11:34355294-34355316 AAGAAACAGCTTTGTTTTTCTGG - Intronic
1081564134 11:44246598-44246620 AAGAAGGAGCATTATATCCTAGG + Intergenic
1081599658 11:44484295-44484317 AGGAAGCAGCACTGTCCCCCAGG + Intergenic
1085743508 11:79096075-79096097 AAGAAGCAGCATTGGAATCCAGG - Intronic
1086537161 11:87861687-87861709 AAGCAGCAGCATTGTTGCGGTGG - Intergenic
1086854434 11:91849419-91849441 CATAATAAGCATTGTTTCCCTGG - Intergenic
1087181855 11:95149912-95149934 ACAAAGGGGCATTGTTTCCCTGG + Intergenic
1087432816 11:98075170-98075192 AAAAAGCAACATTGTATTCCAGG - Intergenic
1088156016 11:106804802-106804824 AAGAAGCAGAGTCTTTTCCCTGG - Intronic
1089195524 11:116692178-116692200 AAGAAGCAGGATTCTGGCCCTGG + Intergenic
1092656458 12:10689982-10690004 GAGAATCAGTATTGTTTCACTGG + Intergenic
1094652742 12:32393489-32393511 AAAAAGAAGTATTATTTCCCTGG + Intergenic
1095095633 12:38146988-38147010 AGGAAGAAGCATGTTTTCCCTGG - Intergenic
1095169258 12:39014387-39014409 AATAAACAACATTGTGTCCCTGG + Intergenic
1095953351 12:47793514-47793536 AGGAAGCAGCACAGTGTCCCCGG + Exonic
1096727447 12:53576095-53576117 AAGAAGCAGAGTTACTTCCCTGG - Intronic
1098391495 12:69974000-69974022 GAGAATCAGCATAGTTTACCTGG + Intergenic
1100797058 12:98193422-98193444 AGGAAGGAGCATTACTTCCCAGG - Intergenic
1101735119 12:107457681-107457703 AAAAAGCAGCACTGTCACCCAGG + Intronic
1104457238 12:128924989-128925011 AAGAAGCAGCATTGTTTCCCAGG - Intronic
1104706088 12:130948617-130948639 ATGAAGCAGCATCGTTTGTCTGG - Intergenic
1107270623 13:38611789-38611811 AAGAAGCAGCATTTATTTCCAGG + Intergenic
1110805620 13:79750999-79751021 AAGAACCAGCATTATTTCACAGG - Intergenic
1113964589 13:114145516-114145538 AAGAAGCCCCATTGGTCCCCAGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114163186 14:20191616-20191638 GAGCAGCAGCAGTGTTTACCTGG - Intergenic
1116211262 14:41947876-41947898 AACAAACAGCATTGCTCCCCAGG + Intergenic
1118636567 14:67753413-67753435 GAGAACCAGCAGTGTTTCTCAGG + Intronic
1118800280 14:69183478-69183500 AAGACTCAGGATTGATTCCCTGG - Intergenic
1122011191 14:98750264-98750286 AACCAGCAGCATGGTTGCCCTGG - Intergenic
1202832421 14_GL000009v2_random:50970-50992 AAGAAGCACCATTGTTTCTAAGG - Intergenic
1124072496 15:26409008-26409030 AAGAAGCAACATTTTTTCCTTGG + Intergenic
1125658549 15:41378090-41378112 AAGCACCTGCATTGTTTCCAAGG + Intronic
1125826200 15:42678542-42678564 AAGCAGCAACAGTGTCTCCCAGG - Intronic
1127210470 15:56769426-56769448 AAGAAGCAGCATTCTGACTCAGG - Intronic
1128234409 15:66057939-66057961 AAGCAGTAGCTTTATTTCCCAGG + Intronic
1130363200 15:83208844-83208866 AAGAAGCAGCATTCGTTCATTGG - Intergenic
1130533378 15:84765094-84765116 AAGAAGTAGAATTGGTTGCCAGG - Intronic
1131016682 15:89063262-89063284 AAGAAGCAGCAATTTTTGGCCGG - Intergenic
1132505260 16:304946-304968 AAGAAGCAGCCCTGTCTCCTGGG - Intronic
1134030645 16:10989790-10989812 AAGTAGCAGCCTTGCTTCTCTGG + Intronic
1134171616 16:11974127-11974149 AAGAAGCATCATAGTCTCTCTGG - Intronic
1134433379 16:14233183-14233205 AAGAAGCTACTTTGTTACCCAGG - Intronic
1135691054 16:24538381-24538403 GAGAAGTAGCAGAGTTTCCCAGG - Intronic
1137240622 16:46652503-46652525 AAAAAGAAGCATTGTTCCCAGGG + Intergenic
1138770122 16:59652980-59653002 GAGAAGCAGCATTTTGGCCCTGG + Intergenic
1141270168 16:82532370-82532392 AAGAAGTAGTATTCTCTCCCAGG + Intergenic
1141364886 16:83433483-83433505 AAAGAGCATCATTGTTTCCTTGG + Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1143713551 17:8750735-8750757 AAGATTCAGCATTATTTTCCAGG + Intergenic
1147187912 17:38722601-38722623 TAGGAGCAGGAGTGTTTCCCTGG + Intronic
1150236545 17:63597623-63597645 GAGAAGCAGCCTTGATTTCCAGG + Intergenic
1150979272 17:70123390-70123412 AGGAAGCAAAAATGTTTCCCAGG - Intronic
1151021032 17:70617683-70617705 AAGAAGCACAAGTGCTTCCCAGG + Intergenic
1151231480 17:72688359-72688381 GAGAAGCTGCATTATTTGCCTGG - Intronic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151421864 17:74003888-74003910 AAGCAGCAGCATGTTTTACCGGG + Intergenic
1153229770 18:2924643-2924665 AAGAGGCAGGATGGTTTCCGGGG + Intronic
1154422316 18:14244357-14244379 AAGAAGCACCTTTGTTTCTAAGG - Intergenic
1155207211 18:23570537-23570559 AAGAAGCAGAATTTCTTCACTGG + Intronic
1156714676 18:39993560-39993582 AAAATGCAGTATTGTTTCCATGG + Intergenic
1157067941 18:44373938-44373960 AGGGAGAAGCATGGTTTCCCAGG + Intergenic
1159609990 18:70514234-70514256 TAGAAGCAACATTGTTTACATGG + Intergenic
1160668053 19:342514-342536 AAGGAGGAGCATTTTATCCCAGG + Intronic
1161034241 19:2075579-2075601 CAGAGGCTGCATTGTTCCCCAGG - Intronic
1165103564 19:33455420-33455442 AGGAAGTAGCATTGTCTTCCTGG - Intronic
1165561113 19:36680810-36680832 AAGAGGCAGCAATGTGACCCCGG - Intergenic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1167853376 19:52218904-52218926 AAGAACCAGCATGGTTTTCTTGG + Intronic
1202640263 1_KI270706v1_random:76764-76786 AAGAATCACCATTGTTTCTAAGG + Intergenic
924959883 2:24884-24906 GAGGAGCAGCATTGCTTCGCCGG - Intergenic
925571753 2:5319654-5319676 AAGAAGAAGCAGTGTCACCCAGG + Intergenic
927194979 2:20540777-20540799 AAGACTCAGCATTGGTGCCCTGG + Intergenic
927242898 2:20934168-20934190 CAGCAGCAGCAATGTTTCCCAGG - Intergenic
928177638 2:29045886-29045908 TAGAAGCAGCCTTGTTTGCAAGG - Intronic
928295352 2:30077982-30078004 AAAAACCATGATTGTTTCCCAGG + Intergenic
928715550 2:34056061-34056083 AATAATCAGCATTGGTGCCCGGG - Intergenic
929490330 2:42390590-42390612 ACACAGCAGCCTTGTTTCCCTGG - Intronic
929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG + Intronic
935104478 2:100027305-100027327 AATAAGCTGCATTATTCCCCAGG + Intronic
938160938 2:128983820-128983842 AGGTAGCAGCATGGTTTCCTGGG - Intergenic
938243479 2:129760622-129760644 AAAAAACAGCAGTGGTTCCCCGG + Intergenic
939192341 2:138931501-138931523 TGGAAGAAGCATGGTTTCCCCGG - Intergenic
939464211 2:142536696-142536718 ACGAAGCTGCATTGGTTGCCAGG + Intergenic
939488976 2:142854091-142854113 GAGAAGCAGCCTGGTTGCCCCGG - Intergenic
941254229 2:163207977-163207999 AACAAGCAGCATTGTTCTCTGGG + Intergenic
941641474 2:167993490-167993512 AACATGCAGCACTGTTTCACTGG + Intronic
942348475 2:175028237-175028259 AAGAGGCATGACTGTTTCCCAGG + Intergenic
942428874 2:175888376-175888398 GTGAAGCAGCAGTATTTCCCTGG - Intergenic
942494541 2:176525952-176525974 AAGAAGCACCATGGGTTCTCAGG - Intergenic
942523103 2:176825259-176825281 AATAAGCACTTTTGTTTCCCAGG + Intergenic
942750046 2:179276942-179276964 AATAACCAGCAGTGATTCCCAGG + Intergenic
943919566 2:193686952-193686974 AAGGACCAACATTGTTTCCATGG - Intergenic
945183186 2:207112609-207112631 AAGAGGCAGCTTTATTCCCCTGG - Intronic
946653718 2:221921796-221921818 GAGAAGGACCATTGGTTCCCAGG + Intergenic
947062668 2:226183971-226183993 AAGAGGCACTATTGTTCCCCTGG - Intergenic
948652893 2:239459516-239459538 AGGAAGCAGCATGATTTCACAGG - Intergenic
1169795128 20:9454202-9454224 AGGAAGCAGCATTGTTTCCATGG - Intronic
1171149356 20:22813439-22813461 GAGGATCAGCATTATTTCCCTGG + Intergenic
1171387040 20:24777439-24777461 TAGAACCAACATTGTTTCCATGG + Intergenic
1174441989 20:50563132-50563154 AAGTTGGAGAATTGTTTCCCTGG - Intronic
1175083978 20:56443835-56443857 GAGAAGCAGCCTTGATTCCCAGG - Intronic
1175682922 20:61004356-61004378 AAGCAGCAGCACTGCTTGCCTGG + Intergenic
1176648588 21:9374350-9374372 AAGAAGCACCATTGTTTCTAAGG + Intergenic
1177619055 21:23562969-23562991 TGGGAGAAGCATTGTTTCCCGGG + Intergenic
1177703204 21:24665278-24665300 AAGAAGAAGAATTTTCTCCCAGG + Intergenic
1179586592 21:42377337-42377359 AAGATGCGGCATTGCTGCCCCGG + Intronic
1180361680 22:11905132-11905154 AAGAAGCACCATTGTTTCTAAGG - Intergenic
1182404761 22:30116876-30116898 AAGAATGAGCATTGTTTGCTTGG + Intronic
1184587036 22:45454864-45454886 AAGAAGCAGTATTTTCTTCCAGG + Intergenic
951316649 3:21195439-21195461 CAGAAATAGCATTTTTTCCCAGG - Intergenic
951402087 3:22245358-22245380 AAGTAGCAGCATGCTTTCCTTGG - Intronic
952040796 3:29258837-29258859 AGGAATAGGCATTGTTTCCCTGG - Intergenic
952129960 3:30350053-30350075 AAGCAGGAGCTATGTTTCCCAGG + Intergenic
952828616 3:37544830-37544852 AAGAGGCAACATTGTTGCCAAGG + Intronic
955722531 3:61898857-61898879 AATAAGTAACATTGTGTCCCTGG + Intronic
955731374 3:61991091-61991113 AGGAAGCAGAATTGTTTCTGGGG - Intronic
958105811 3:89071007-89071029 ATGAACCAGCATTGCATCCCAGG - Intergenic
958762441 3:98325507-98325529 ATGAAGCGGCATTGTTTGTCTGG - Intergenic
958896457 3:99835184-99835206 AATAAGCAGCACTGATTCCTGGG + Intronic
962485279 3:135836354-135836376 AAGAAGCAGCCTCTATTCCCTGG - Intergenic
962686172 3:137849959-137849981 GAGAAGCAGCATGGTTTCAGAGG + Intergenic
962991420 3:140580781-140580803 AAGTGGCAGCATTTTATCCCTGG - Intergenic
964530004 3:157657313-157657335 AGGAGGCAGCATGGTTTCCATGG - Intronic
965184660 3:165447167-165447189 AAGAATCAGAATTGTTTTTCTGG - Intergenic
965392062 3:168117112-168117134 AAGAAACAGCATTCTCTCTCAGG - Intergenic
966340749 3:178923265-178923287 TGGAAGAAGCATGGTTTCCCTGG - Intergenic
966548363 3:181177320-181177342 AAGACAAAGCATTATTTCCCAGG - Intergenic
966553394 3:181230525-181230547 AAGAAGCAGAATACTTCCCCTGG - Intergenic
967820395 3:193834344-193834366 AAGGAGCAGCAGTGCTTTCCTGG - Intergenic
1202738291 3_GL000221v1_random:30636-30658 AAGAAGCACCATTGTTTCTAAGG - Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
969057175 4:4409269-4409291 AAGAAGCCCCACTGTTGCCCAGG - Intronic
969061387 4:4438071-4438093 GAGAGGCAGCATTGCCTCCCTGG - Intronic
972125114 4:35755230-35755252 AAGAACCAGTCTTGTATCCCTGG + Intergenic
972271098 4:37511363-37511385 AAGAACCAGCAGTGGTACCCAGG - Intronic
972413644 4:38817841-38817863 AATAAGCAGCAATGTTTCCTTGG + Intronic
972742403 4:41900628-41900650 AACATGCAGGATTGTTACCCAGG + Intergenic
973370502 4:49243120-49243142 AAGAAGCACCTTTGTTTCTAAGG + Intergenic
973383776 4:49487279-49487301 AAGAAGCACCATTGTTTCTAAGG + Intergenic
973390523 4:49552296-49552318 AAGAAGCACCTTTGTTTCTAAGG - Intergenic
974229328 4:59089914-59089936 AAGAATCAGGATTGATTGCCAGG + Intergenic
974283951 4:59839382-59839404 AAGATGCAGGATTGTTACACAGG + Intergenic
974546927 4:63323375-63323397 AAGCAGCTCCTTTGTTTCCCTGG + Intergenic
975210967 4:71699379-71699401 AAGAAGCAGCAATCTTGCCCTGG - Intergenic
975404836 4:73977124-73977146 AAGAGGCAGCCTCCTTTCCCAGG - Intergenic
975489793 4:74976052-74976074 CAGAAAAAGCATGGTTTCCCTGG - Intronic
976834652 4:89357505-89357527 GAGAAGCAGGATTGTGCCCCAGG - Intergenic
977293387 4:95187392-95187414 AAGAAGATGCATTGTATTCCAGG + Intronic
977688568 4:99877028-99877050 CAGTAGCAGCCCTGTTTCCCCGG - Intergenic
977784069 4:101012596-101012618 TAGAAGCAGCAATGGTTCACTGG + Intergenic
978099161 4:104815792-104815814 AATAAGCAAGTTTGTTTCCCAGG + Intergenic
978370386 4:108024075-108024097 AAGAAGCAGCATGGTTTAGTGGG + Intronic
978456823 4:108902701-108902723 AGGAAGCAGAATTTTTTTCCAGG - Intronic
979849303 4:125556550-125556572 AAGAAGCAGAATAGTTTCAGGGG - Intergenic
980787489 4:137573258-137573280 TAGAAAAAGCACTGTTTCCCTGG + Intergenic
980990212 4:139733088-139733110 AAGAAACAGCTTTATTTCACTGG - Intronic
981829336 4:148982076-148982098 AAGATTCTGCATTGTTTCACAGG + Intergenic
982285703 4:153731873-153731895 TAATAGCAGCATTGTTTCCTGGG - Intronic
983605550 4:169579398-169579420 AAGAATCAGCATGATTTCTCTGG - Intronic
984842484 4:184081023-184081045 AAGAAGCTGCATTCTGGCCCGGG + Intergenic
1202767623 4_GL000008v2_random:162622-162644 AAGAAGCACCATTGTTTCTAAGG + Intergenic
986078003 5:4357820-4357842 AAAAAGCAGCAGTGTCTCTCAGG - Intergenic
987289080 5:16490898-16490920 AAAAAGCGGCTTTGGTTCCCAGG + Intronic
987450914 5:18083187-18083209 AAGAAGCACCATCATTTACCAGG - Intergenic
988426595 5:31072482-31072504 AAGAAGCAGCTTTATTTCCTTGG + Intergenic
988446809 5:31295723-31295745 AAGAACCAGCAGTGTAGCCCTGG + Intronic
988832782 5:35003762-35003784 CAGAGGCAGCATTTTTTCTCAGG - Exonic
990596826 5:57320622-57320644 AAGAACCTTCATTCTTTCCCTGG - Intergenic
993353430 5:86877501-86877523 ATGAAGCAGCATTGTTGTCTGGG - Intergenic
994084006 5:95738963-95738985 ACACAGCAGAATTGTTTCCCAGG + Intronic
994346925 5:98697877-98697899 CTGGAGAAGCATTGTTTCCCAGG + Intergenic
995046065 5:107649623-107649645 AAGAGGCAGCATTTGATCCCAGG + Intronic
995428407 5:112049114-112049136 TAGGAGAAGCATGGTTTCCCGGG - Intergenic
995671861 5:114613393-114613415 AATAAGTAGCAGTGTATCCCCGG + Intergenic
995747565 5:115419512-115419534 AAAAAGAAGCATTGTTTACAGGG + Intergenic
996130305 5:119773357-119773379 AAGAATCAGCCTTGCATCCCAGG - Intergenic
996426014 5:123313892-123313914 AAGGAGAAGCATGGTTTCCCAGG + Intergenic
1002086454 5:176778814-176778836 AAGAAGCAGCATTGGAGCCGAGG - Intergenic
1002319210 5:178365175-178365197 AATAAGCAAAATTGTTTTCCTGG + Intronic
1002710019 5:181189873-181189895 AAAAATGAGCATTGTTTCCTCGG - Intergenic
1007553146 6:42745629-42745651 ACGAAGCAGCATCCTTTCCCCGG + Exonic
1007555539 6:42762734-42762756 ACGAAGTATCATTGTTGCCCAGG - Intronic
1008301389 6:49844746-49844768 AGGAAGCAGCAATGGGTCCCAGG - Intronic
1008819043 6:55609019-55609041 AGGAAAAAGCATGGTTTCCCTGG - Intergenic
1008896676 6:56564884-56564906 ATGAACCAGCCTTGCTTCCCAGG + Intronic
1012349916 6:98237238-98237260 AAGAAACTTCATTGGTTCCCAGG + Intergenic
1012704857 6:102510839-102510861 AAGAAGCAGCATTATCTTCTGGG - Intergenic
1013625306 6:111931309-111931331 TTGAAGCAGCATTGCATCCCAGG + Intergenic
1013931920 6:115545024-115545046 ATGAAAAAGCATGGTTTCCCAGG - Intergenic
1016944087 6:149512011-149512033 AAGAAGCAGAATGGTTGCACTGG - Intronic
1019894157 7:3970776-3970798 AAGATGCAGAATTGTTTTTCTGG + Intronic
1020652113 7:10888481-10888503 AAGAAGGAGCACGATTTCCCAGG - Intergenic
1021746179 7:23743364-23743386 AAGAAGTAGTAGTCTTTCCCAGG - Intronic
1021915350 7:25426060-25426082 AGGATGCAGGAATGTTTCCCAGG + Intergenic
1022904331 7:34841228-34841250 TGGAAGCAGAATTGTTTCCTGGG - Intronic
1023056700 7:36296373-36296395 AAGAAACAGCCTGGCTTCCCAGG - Intronic
1024006872 7:45231111-45231133 AGGAAGCAACATTTTATCCCTGG - Intergenic
1024058191 7:45679578-45679600 AGGAAGCAGCATCGTTAACCTGG - Intronic
1024267021 7:47614630-47614652 AAGCAGCAGCAGTGCTTTCCAGG + Intergenic
1025829389 7:65036695-65036717 AAGAAGCAGCAGGCTTACCCCGG - Intergenic
1026222451 7:68412266-68412288 GTGAAGCAGCATTGTTGCCTGGG - Intergenic
1026463680 7:70635679-70635701 AAGATTCAGCAGTGTTTTCCAGG - Intronic
1026626052 7:71993438-71993460 AAAAAGCCTCATTGTTGCCCAGG - Intronic
1027294291 7:76751447-76751469 AAGAAGCAGCATAGTTTGAGGGG + Intergenic
1027430807 7:78110716-78110738 AGGAAGCAGCAATGTTCCACAGG + Intronic
1027583226 7:80023896-80023918 TTGAACCAGCCTTGTTTCCCAGG - Intergenic
1028681182 7:93534393-93534415 AAGAGGCAGCATTGTGTACAGGG - Intronic
1030401893 7:109062132-109062154 AAAAATCAGCATTTTTTTCCAGG - Intergenic
1030629430 7:111879307-111879329 AATAACCAGCAGTGTTACCCAGG + Intronic
1033097024 7:138441099-138441121 AAGATGCAGCATGGCTTCTCGGG + Intergenic
1034086451 7:148326960-148326982 AGGAAGCTGCCTTGTTTACCTGG - Intronic
1036510316 8:9393933-9393955 AGGAAGCAGTATGGTGTCCCAGG - Intergenic
1037254819 8:16941747-16941769 AATAAGCAGCAGTGATACCCAGG + Intergenic
1037917216 8:22779912-22779934 TAAAAGCAGCATGGATTCCCAGG + Intronic
1039494324 8:37969310-37969332 AAGAACCAGCCTCGTCTCCCAGG + Intergenic
1040431404 8:47346287-47346309 ATGAAGCAGCCTTGCATCCCAGG + Intronic
1042741707 8:72055435-72055457 AAAAAGGTGCATTGTTTCTCAGG - Exonic
1042757329 8:72230046-72230068 AAAAAGGTGCATTGTTTCTCAGG - Intergenic
1044135905 8:88584958-88584980 TAGAAAAAGCATGGTTTCCCAGG + Intergenic
1044596683 8:93966136-93966158 TTGAAGCAGCCTTGTATCCCAGG + Intergenic
1046657763 8:116913403-116913425 TGGAAGAAGCATGGTTTCCCAGG + Intergenic
1051217279 9:14811972-14811994 AATATGCAGCATTGTTACCAAGG + Intronic
1052222684 9:26046528-26046550 AGGAAGCAGCCTTGCATCCCAGG - Intergenic
1052507591 9:29375916-29375938 AATAAGCAGCATCGTTAGCCTGG - Intergenic
1059412451 9:114141101-114141123 AACAAGGAGGATTGTTTGCCTGG - Intergenic
1060814925 9:126630176-126630198 AAAAAGCACTATTGTTTGCCTGG + Intronic
1061789028 9:133048870-133048892 AAGAACCTGCATTTTCTCCCAGG + Intronic
1203692037 Un_GL000214v1:51574-51596 AAGAAGCACCATTGTTTCTAAGG + Intergenic
1203707021 Un_KI270742v1:61081-61103 AAGAAGCACCATTGTTTCTAAGG - Intergenic
1203548380 Un_KI270743v1:147494-147516 AAGAAGCACCATTGTTTCTAAGG + Intergenic
1203644258 Un_KI270751v1:52617-52639 AAGAAGCACCATTGTTTCTAAGG - Intergenic
1185798136 X:2984495-2984517 AAGAAGCATCAGTGTTACACAGG - Intergenic
1186015196 X:5183439-5183461 AAGAAGCAGCCATGTTTTTCAGG + Intergenic
1186743816 X:12545475-12545497 AAGATGCATCAAAGTTTCCCTGG + Intronic
1186775090 X:12856722-12856744 AAGATGCATCAAAGTTTCCCTGG - Intergenic
1187265325 X:17726760-17726782 AAGAGGCAGCTTCATTTCCCTGG - Exonic
1187844904 X:23525026-23525048 AATAAGCAGCAGTGATACCCAGG + Intergenic
1188137988 X:26513055-26513077 TTGAAGCAGCATTGTTTCTTTGG - Intergenic
1188432932 X:30127003-30127025 AAGAAGCAGCATTTTTCCCTTGG - Intergenic
1188532787 X:31161164-31161186 AAGAAACATCATTGTTTTCCTGG - Intronic
1191603948 X:63041594-63041616 AAGAAGCAACTTTGGATCCCAGG - Intergenic
1191985554 X:66976333-66976355 TTGAAGCAGCCTTGTTTCCCAGG + Intergenic
1195129719 X:101840393-101840415 AAGAAGCAGCCTTGGTCCTCTGG - Intronic
1195176519 X:102319430-102319452 AAGAAGCAGCCTTGGTCCTCTGG + Intronic
1195182345 X:102367663-102367685 AAGAAGCAGCCTTGGTCCTCTGG - Intronic
1195202386 X:102564130-102564152 AAGAAGCAGCCTTGGTCCTCTGG + Intergenic
1196053838 X:111333896-111333918 AGGAAGCAGCATACTTTCCCAGG - Intronic
1196068339 X:111490483-111490505 AAGCAGCAGTAATGTTTCCTGGG + Intergenic
1196622211 X:117836689-117836711 AAGAAGGAGCTTTTTTCCCCTGG - Intergenic
1196996447 X:121388945-121388967 CAGAAGCACCACTTTTTCCCAGG + Intergenic
1197124212 X:122925120-122925142 TAGAAAAAGCATGGTTTCCCAGG + Intergenic
1197259741 X:124305271-124305293 ATAAAGCAGCTTTGTTTTCCAGG + Intronic
1197397259 X:125941778-125941800 AATCTGCAGGATTGTTTCCCAGG - Intergenic
1198826435 X:140702993-140703015 AAGCAGCAGCATGGTTTCAGAGG - Intergenic
1199645731 X:149909214-149909236 AATAACCAGCAGTGATTCCCAGG + Intergenic
1199699521 X:150365147-150365169 AAAAAGCCCCTTTGTTTCCCAGG + Intronic
1201635996 Y:16124074-16124096 GAGAAGTGGCATTGTCTCCCTGG - Intergenic