ID: 1104457731

View in Genome Browser
Species Human (GRCh38)
Location 12:128929102-128929124
Sequence CCAGGTCCTCGCTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104457731_1104457739 0 Left 1104457731 12:128929102-128929124 CCTTCCACCAAGCGAGGACCTGG 0: 1
1: 0
2: 1
3: 31
4: 258
Right 1104457739 12:128929125-128929147 CGAGCATCTGGATGGGAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 131
1104457731_1104457737 -7 Left 1104457731 12:128929102-128929124 CCTTCCACCAAGCGAGGACCTGG 0: 1
1: 0
2: 1
3: 31
4: 258
Right 1104457737 12:128929118-128929140 GACCTGGCGAGCATCTGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1104457731_1104457736 -8 Left 1104457731 12:128929102-128929124 CCTTCCACCAAGCGAGGACCTGG 0: 1
1: 0
2: 1
3: 31
4: 258
Right 1104457736 12:128929117-128929139 GGACCTGGCGAGCATCTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104457731 Original CRISPR CCAGGTCCTCGCTTGGTGGA AGG (reversed) Intronic
900374044 1:2345274-2345296 CCTGGCCCTGGCCTGGTGGAAGG - Intronic
900798855 1:4725575-4725597 CCAGCTCCTTCCTTGGTGGCGGG + Intronic
900814473 1:4832940-4832962 CAATGTCCTCACATGGTGGAAGG + Intergenic
901233700 1:7656032-7656054 CTAGGTCATTGCATGGTGGAAGG - Intronic
902189551 1:14752569-14752591 CTATGTCCTCACATGGTGGAAGG + Intronic
902907739 1:19571179-19571201 CCATGTCCTCACATAGTGGAAGG - Intergenic
905210855 1:36373220-36373242 CCAGGTCTTTGCTGGGTGAAGGG + Intronic
906704566 1:47885532-47885554 ACAGGTCCTCTGTTGGTGGCAGG + Intronic
907390896 1:54157641-54157663 CCATGTCCTCACATGGTGGAAGG + Intronic
911610925 1:99958455-99958477 CCATGTCCTCACATAGTGGAAGG - Intergenic
915624524 1:157106570-157106592 CCACGTCATCGCCTGCTGGAGGG - Intergenic
915647514 1:157284299-157284321 CCGTGTCCTCACATGGTGGAAGG + Intergenic
915647555 1:157284543-157284565 CTATGTCCTCACATGGTGGAAGG + Intergenic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
915663109 1:157420037-157420059 CCTTGTCCTCACATGGTGGAAGG - Intergenic
915663130 1:157420159-157420181 CCATGTCCTCACATGGTGGAAGG - Intergenic
916142860 1:161714205-161714227 CCACGTCCTCATATGGTGGAAGG - Exonic
916179485 1:162070971-162070993 CCAGGTCCACCGTTGGGGGAGGG + Intronic
917489846 1:175488813-175488835 CCAGGTCCCCGAAGGGTGGATGG + Intronic
917585777 1:176425426-176425448 CCAGGGCCTTGCCTGGTGAAGGG + Intergenic
919686783 1:200490630-200490652 ACAGCTCCTCTCTTGGAGGAAGG + Intergenic
921287825 1:213624745-213624767 CCGTGTTCTCACTTGGTGGAAGG + Intergenic
924485739 1:244481776-244481798 CTGGGTCCTCGCATGGCGGAAGG - Intronic
1062909891 10:1205630-1205652 CCGCGTCCTCCCATGGTGGAAGG - Intronic
1063230954 10:4065207-4065229 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1063615981 10:7600834-7600856 GCATGTCCTCCCATGGTGGAAGG - Intronic
1064328195 10:14370380-14370402 CTATGTCCTCACATGGTGGAAGG - Intronic
1064918297 10:20486941-20486963 CCAGCTCCTGGCTTGGCTGATGG - Intergenic
1065361033 10:24889178-24889200 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1067822117 10:49539518-49539540 CCAGGTGCGCGCGTGGCGGAGGG - Exonic
1068848533 10:61708578-61708600 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1073529915 10:104221474-104221496 CCATGTCCTCACATGGTAGAAGG - Intronic
1074811829 10:117112409-117112431 CCAGGCCCTCTATTGGTGGTGGG - Intronic
1074884154 10:117681811-117681833 CCAGGGCCTGGCGTGGTGCATGG - Intergenic
1074917762 10:117974018-117974040 CTATGTCCTCACATGGTGGAAGG + Intergenic
1074945181 10:118274671-118274693 CCAGGTGCTGGCTGGGTGTAAGG - Intergenic
1075989043 10:126817299-126817321 CCATGTCCTCACATGGTAGAAGG - Intergenic
1076062376 10:127423429-127423451 CCTGCTCCTCGCTGGGTGGGAGG + Intronic
1077107481 11:848402-848424 CCAGGTCCTCGCTGGGGGAAGGG - Intronic
1080565645 11:33506910-33506932 CCAGGGCCTAGGTTAGTGGATGG + Intergenic
1081337084 11:41880075-41880097 CTATGTCCTCACATGGTGGAAGG - Intergenic
1081568634 11:44276045-44276067 CCATGGCCTCCCTGGGTGGAAGG + Intronic
1081591330 11:44425348-44425370 CAAGGTGCTGGCTTGGTGGGTGG + Intergenic
1083915829 11:65743247-65743269 CCGTATCCTCGCATGGTGGAAGG + Intergenic
1084415881 11:69032775-69032797 CCAGCTCCTGGCTTGGCTGAGGG - Intergenic
1084775251 11:71370608-71370630 CCAGGTCCTCACCTGGTGCTGGG - Intergenic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1088489973 11:110377592-110377614 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1088840672 11:113624999-113625021 CTATGCCCTCACTTGGTGGAAGG + Intergenic
1089116169 11:116096966-116096988 CCAGCTTCTTGCTGGGTGGAGGG - Intergenic
1089277288 11:117346127-117346149 CCAGTACCTAGCTTGATGGATGG + Intronic
1089648456 11:119895519-119895541 CCAGGTCTTGGCTTGGAGGAAGG + Intergenic
1090755861 11:129791109-129791131 CTATGTCCTTACTTGGTGGAAGG - Intergenic
1091332072 11:134737700-134737722 CCAGGTCCCACCTTGGAGGAGGG + Intergenic
1091780977 12:3214527-3214549 CCAGTTCCTTGCTTAGTGGTGGG + Intronic
1092294821 12:7189694-7189716 CCAGGTGCTGGCTTGGGGGAGGG - Exonic
1094636022 12:32227614-32227636 CCAGGACCTCCCATGATGGATGG - Intronic
1095399149 12:41794676-41794698 CCAGGAACTCGCTTGAAGGAAGG + Intergenic
1099438494 12:82671111-82671133 CCAGGTCCCCACATGATGGAAGG - Intergenic
1099970030 12:89490905-89490927 CCAGGTCCTGGCTTGGATCAAGG - Intronic
1100442283 12:94628058-94628080 CCCGCTCCTGACTTGGTGGAAGG + Intronic
1100677354 12:96881879-96881901 CAGTGTCCTCACTTGGTGGAAGG + Intergenic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1101426471 12:104592424-104592446 CTATGTCCTCACATGGTGGAGGG + Intronic
1101469109 12:104978201-104978223 CTATATCCTCACTTGGTGGAAGG + Intergenic
1102598287 12:114009835-114009857 CTCTGTCCTCGCATGGTGGAAGG + Intergenic
1104078146 12:125408437-125408459 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1104092017 12:125525450-125525472 CCATGTCCTCGCATGGCGGAAGG - Intronic
1104207916 12:126657827-126657849 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1104382858 12:128323197-128323219 TGAGGTCCTGGCTTGGTGCAAGG + Intronic
1104414714 12:128588722-128588744 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1104457731 12:128929102-128929124 CCAGGTCCTCGCTTGGTGGAAGG - Intronic
1105620372 13:22060812-22060834 CCACGTCCTTGCCTGGTGAATGG + Intergenic
1105658805 13:22470561-22470583 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1108606073 13:52039997-52040019 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1113553445 13:111211957-111211979 ACAGATCCTCGCCTGGGGGATGG - Intronic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1115770027 14:36658360-36658382 CCTGGGCCTCGCTTGGGGGGGGG + Intronic
1117803816 14:59469703-59469725 CAAGTCCCTAGCTTGGTGGATGG + Intronic
1118072529 14:62261427-62261449 CTGGGTCCTCACGTGGTGGAAGG - Intergenic
1119176085 14:72568538-72568560 CCAGGTCCTCACTGGGAAGAAGG - Intergenic
1120095610 14:80384429-80384451 CTATGTCCTCACATGGTGGAAGG + Intronic
1120508964 14:85389489-85389511 CTATGTCCTCCCATGGTGGAAGG + Intergenic
1120535256 14:85687219-85687241 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1120852952 14:89187391-89187413 CCAGGTCTTCTCTAGGTTGAGGG - Intronic
1121968054 14:98328846-98328868 CCATGTCCTCACATGGTAGAAGG + Intergenic
1122374218 14:101247741-101247763 CCAGGGCATCGCGTGGTGGGAGG - Intergenic
1122398759 14:101454467-101454489 CCAGGACCTGCCTTGGTGCAGGG + Intergenic
1122833499 14:104417747-104417769 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1122946252 14:105011571-105011593 CCTGCTCCTGGCTTGGGGGACGG - Exonic
1124354809 15:28986976-28986998 CTACATCCTCACTTGGTGGAAGG + Intronic
1124412240 15:29446091-29446113 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1124598993 15:31115940-31115962 CTATGTCCTCACATGGTGGAAGG + Intronic
1124719208 15:32097453-32097475 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1128756697 15:70188140-70188162 CCTGGACCTGGCTTGGTTGAAGG + Intergenic
1132104306 15:99051626-99051648 CTAGCTCCTCGCTTTGTGGGTGG + Intergenic
1135068671 16:19333332-19333354 CCAGGTCCTCCCATGGTATAGGG - Intergenic
1135164906 16:20130606-20130628 CAAGGGCCTCGTCTGGTGGAGGG + Intergenic
1135970740 16:27070376-27070398 CCATGCCCTCGCATGGTGGAAGG + Intergenic
1136901331 16:34041466-34041488 CCATGTCCTCACATAGTGGAAGG + Intergenic
1138677822 16:58664955-58664977 GCAGGTCCCTGCTTGGTAGAGGG + Intergenic
1141711683 16:85703230-85703252 CCATGTCCTTGCCTGGTGGAAGG - Intronic
1142968321 17:3594770-3594792 CCAGGTACTGGCTGGGCGGAGGG + Intronic
1143101179 17:4505678-4505700 CCTGGTCCTCGCCTGGTGGCTGG + Intronic
1143648506 17:8248066-8248088 GCAGGTGCTCGCTTGGGGGTGGG + Intronic
1144464231 17:15483855-15483877 TCAAGTCCTCTCTTGGAGGAGGG + Intronic
1145202169 17:20956068-20956090 CCAAGTCCTGTCCTGGTGGAGGG - Intergenic
1149359971 17:55884893-55884915 CTATGTCCTCACATGGTGGATGG - Intergenic
1149384877 17:56132756-56132778 CCATGTCCTCACATGGTGGAAGG + Intronic
1149937716 17:60825695-60825717 CCATGTCCTCACATGGTGGAAGG + Intronic
1152238674 17:79151062-79151084 CCAGGGCCCAGCATGGTGGAGGG - Intronic
1152372194 17:79895891-79895913 CTGAGTCCTCACTTGGTGGAAGG - Intergenic
1153993100 18:10417378-10417400 CCAGGTCCTTGCTGTGTGGGAGG - Intergenic
1155487048 18:26356170-26356192 CTATGTTCTCACTTGGTGGAAGG + Intronic
1156525973 18:37767735-37767757 TCATGTCCTCACATGGTGGAAGG + Intergenic
1157482184 18:48062319-48062341 CCAGGTCCTCCCTGGGGAGAGGG - Intronic
1157689008 18:49665573-49665595 CTATGTCCTCACATGGTGGAAGG + Intergenic
1163338242 19:16687649-16687671 CTGTGTCCTCGCATGGTGGAAGG + Intronic
1163408746 19:17140344-17140366 CCATGTCCTCACACGGTGGAAGG + Intronic
1165239603 19:34455328-34455350 TCAGGTCCTTGCTTTGTGTAAGG + Intronic
1165742371 19:38211642-38211664 CCAAGGCCTGGCTGGGTGGAGGG - Intronic
1167740802 19:51323907-51323929 CCGGGGCCTGGCTGGGTGGAGGG + Intronic
1168008766 19:53512907-53512929 CCAGGGACTGGTTTGGTGGAAGG - Intergenic
1168045720 19:53792889-53792911 CCTGATCCTCCCTTGCTGGAGGG - Intergenic
925047098 2:780765-780787 CCTGGTCCTCACTGGGTGGTAGG - Intergenic
925496091 2:4450907-4450929 CCAGGTCCTCACATGGCAGAAGG - Intergenic
925744178 2:7030675-7030697 CCAGGGACTCACTTCGTGGAAGG + Intronic
927092419 2:19722219-19722241 CCATGTCCTCGCATGGTGGAAGG + Intergenic
928242432 2:29597988-29598010 CTAGCTCCTCACTTTGTGGAGGG + Intronic
928266081 2:29813001-29813023 CCAGGTCCTGGTTTCCTGGAAGG - Intronic
928874656 2:36023894-36023916 CTATGTCCTCACCTGGTGGACGG - Intergenic
930163223 2:48178896-48178918 ACATGTCCTCACATGGTGGAAGG + Intergenic
932326010 2:70862288-70862310 CCAGGTGCTGGCTTCATGGAAGG + Intergenic
937134351 2:119540115-119540137 CTATGTCCTCACGTGGTGGAAGG - Intergenic
944087931 2:195870703-195870725 CCATGTCCTCAAATGGTGGAAGG - Intronic
944540285 2:200747757-200747779 CCAGGTCCTCATTATGTGGAGGG + Intergenic
944636478 2:201680392-201680414 CTGGGTCCTCCCATGGTGGAAGG + Intronic
945609672 2:211984162-211984184 CCATGTCCTCACATGGTGGAAGG + Intronic
946658977 2:221979072-221979094 CCATGTCCTCACATGGTGGTGGG - Intergenic
947994960 2:234519502-234519524 CCATGCCCTCACATGGTGGAAGG + Intergenic
948570267 2:238913322-238913344 CCAGGGCCTGGCTGGGTGCAGGG - Intergenic
948642287 2:239383320-239383342 GCAGATCCTCGCTTGGAGGCTGG + Intronic
948662118 2:239514135-239514157 CCAGGTCCTGTGTTGGGGGATGG - Intergenic
1169942985 20:10957534-10957556 CAAGGTCCTAGCATGGTGGCAGG + Intergenic
1171070330 20:22062175-22062197 CCAGGTCCCCACTTATTGGATGG + Intergenic
1171221189 20:23399392-23399414 CTATGTCCTCACGTGGTGGAAGG - Intronic
1175156733 20:56976485-56976507 CCAGGCCCTGGCTTGGTGCTGGG - Intergenic
1175433475 20:58925515-58925537 CCAAGACCTTGCCTGGTGGAGGG + Intergenic
1175916680 20:62429211-62429233 TCGGGTCCTCACATGGTGGAAGG - Intergenic
1176039257 20:63055823-63055845 CCTTGTCCTCGCTGGGTGGCAGG + Intergenic
1178982028 21:37272382-37272404 CCATGTCCTCTCTTGGCAGAAGG - Intergenic
1179219591 21:39394655-39394677 CTATGTCCTTGCATGGTGGAAGG + Intronic
1181531031 22:23517570-23517592 CCTTGTCCTCACGTGGTGGAAGG - Intergenic
1182500166 22:30740986-30741008 CCTGGTCGTGGCTTGGTTGAGGG - Intronic
1184776571 22:46626425-46626447 CGGGGGCCTCGCTTGGTGGGAGG + Intronic
950739956 3:15042563-15042585 CCAGGTTTTCTCTTGGTGGTGGG + Intronic
953962062 3:47273897-47273919 CCGGATCATCTCTTGGTGGAGGG - Intronic
954146271 3:48635759-48635781 CCAGGTCCTGGCTCGGCGGAAGG + Intergenic
954643391 3:52115687-52115709 CTGTGTCCTCGCGTGGTGGAAGG - Intronic
955797532 3:62653320-62653342 CCAGGTCCTCACATGCTGGCAGG - Intronic
956777208 3:72575252-72575274 CCAGGCCCTCGCTAGGTGCTGGG + Intergenic
956946077 3:74225296-74225318 CTATGTCCTCACATGGTGGAAGG + Intergenic
958805713 3:98807427-98807449 CCCGATCCTCTCATGGTGGAAGG - Intronic
959178918 3:102953900-102953922 CTGTGTTCTCGCTTGGTGGAGGG - Intergenic
959349837 3:105248312-105248334 CCATGTCCTCACGTGGTGGAGGG - Intergenic
959891678 3:111563050-111563072 CCATGTCCTCACATGGTGGAAGG + Intronic
960392346 3:117092927-117092949 GCTGGTCCTCACATGGTGGAAGG + Intronic
960694856 3:120386145-120386167 CTGTGTCTTCGCTTGGTGGAAGG - Intergenic
962204078 3:133420941-133420963 CCAGGGCCTCTCTTGTGGGAAGG - Intronic
966916569 3:184587546-184587568 CCAGGTTCTAGCTTGGGGGTGGG + Intronic
968086472 3:195876156-195876178 CCAGGGGCTCGTTTGGAGGAAGG - Intronic
971112609 4:23605873-23605895 TCATGTCCTCACATGGTGGAAGG + Intergenic
972404027 4:38730009-38730031 CCATGTCCTCCCAAGGTGGAAGG + Intergenic
976118461 4:81754058-81754080 CTATGTCCTCACTTGGTGGAAGG + Intronic
976285013 4:83362886-83362908 CTATGTCCTCACATGGTGGAAGG - Intergenic
976839795 4:89418779-89418801 CTATGTCCTCACATGGTGGAAGG + Intergenic
979437724 4:120713905-120713927 CCCTGTCCTCACATGGTGGAAGG + Intronic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982294921 4:153817968-153817990 CCATGTCCTCACGTGGAGGAAGG - Intergenic
984523752 4:180831649-180831671 CTGAGTCCTCACTTGGTGGAGGG + Intergenic
984885886 4:184449093-184449115 CCTGGTCCAGGCTTTGTGGAAGG - Intronic
985679677 5:1249385-1249407 CCAGGCCCACCCTTGCTGGAAGG - Intergenic
989450131 5:41577222-41577244 CCATGTCTTCACATGGTGGAAGG + Intergenic
989753758 5:44926015-44926037 TTATGTCCTCCCTTGGTGGAAGG + Intergenic
991445250 5:66692770-66692792 CTATGTCCTCACTTGGTGGAAGG + Intronic
991582810 5:68174459-68174481 CCGTGTCCTCACATGGTGGAAGG + Intergenic
992035111 5:72766032-72766054 CCATGTCCCCACATGGTGGAAGG + Intergenic
994577467 5:101596841-101596863 CCTTGTCCTCACATGGTGGATGG - Intergenic
996993709 5:129668494-129668516 CTATGTCCTCACATGGTGGAAGG + Intronic
997994532 5:138575226-138575248 CCAGTTCCTCACCTGGTGGCGGG + Exonic
998391047 5:141787193-141787215 CCTTGTCCTCCCATGGTGGAGGG - Intergenic
999048270 5:148492909-148492931 CCAGCTTCTGGCTTGGTGGAAGG - Intronic
999103313 5:149046068-149046090 ACAGGACCTGGCCTGGTGGAGGG - Intronic
999391994 5:151199944-151199966 TCAGGTGTTCGCTGGGTGGAAGG - Intronic
999734229 5:154500616-154500638 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1001923749 5:175621051-175621073 CCATGTCCTCACATGGTGGAAGG - Intergenic
1002459903 5:179368156-179368178 CCAGGTCCTCCCAGGGAGGAGGG + Intergenic
1003868014 6:10381289-10381311 CAAGCCCCTCGCTGGGTGGACGG - Intergenic
1003946216 6:11078269-11078291 CTATGTCCTCACATGGTGGAAGG - Intergenic
1004233295 6:13851803-13851825 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1004759825 6:18654338-18654360 CTAGGTCCTCACATGGTGAAAGG - Intergenic
1005013442 6:21357100-21357122 CCTGGTCCTCCCTTTGTGCAAGG - Intergenic
1005017771 6:21390410-21390432 CCGTGTCCTCACTTGGTGGAAGG - Intergenic
1005269863 6:24152273-24152295 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1006502599 6:34467965-34467987 CCTGGTCCTGGCTTGAGGGAAGG + Intronic
1006644260 6:35505467-35505489 CCAGGGCCTCACTTGGAGCAGGG - Intronic
1006814832 6:36843080-36843102 ACACTTCCTCACTTGGTGGAAGG + Intergenic
1008679048 6:53853030-53853052 CCATGTCCTCACATTGTGGAAGG + Intronic
1009532043 6:64830143-64830165 CCATGTCCTCACATGGTGGAAGG - Intronic
1010162969 6:72880339-72880361 CTATGTCCTCACATGGTGGAAGG + Intronic
1015776368 6:136818857-136818879 CCGTGTCCTCACGTGGTGGAAGG + Intergenic
1015975594 6:138787292-138787314 CCATGTCCTCACATGGTAGAAGG - Intronic
1016409539 6:143767658-143767680 CCATGTCATCACATGGTGGAAGG + Intronic
1016926613 6:149356554-149356576 CTATGTCCTCGCATGGTGGAAGG + Intronic
1017429597 6:154358133-154358155 CCATGTCCTCATATGGTGGAGGG - Intronic
1017792880 6:157817023-157817045 CTATGTCCTCACATGGTGGAAGG - Intronic
1018719275 6:166560656-166560678 CCAAGGCCCCGCTTGGTGGGAGG + Intronic
1018738215 6:166705982-166706004 CCAAGTCCTCACGTGGTGGAAGG - Intronic
1018756734 6:166856321-166856343 CCTTGTCCTCACGTGGTGGAAGG - Intronic
1019791947 7:3020074-3020096 CCGTGTCCTCACATGGTGGAAGG - Intronic
1020220624 7:6233924-6233946 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1020366571 7:7386968-7386990 CCGTGTCCTCACATGGTGGAAGG + Intronic
1021525385 7:21580649-21580671 CCATGTCCTTACTTGGTGGAAGG + Intronic
1022442964 7:30448714-30448736 CCTGGTTCTCGTATGGTGGAGGG + Intronic
1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG + Intronic
1023305355 7:38820066-38820088 TCAGGTTCTCGCTTTGGGGATGG - Intronic
1023890170 7:44386284-44386306 CCAGTACCTCCCTTGGTCGAAGG - Intronic
1025478871 7:60958005-60958027 CCAGGGCATCTCTTGGTGCAAGG - Intergenic
1028916980 7:96269944-96269966 CCAGGGCCTCCCTTGGGGGAAGG + Intronic
1029614231 7:101646115-101646137 CCAGGGCCTGGCGTGGTGGGGGG - Intergenic
1031681061 7:124675210-124675232 CCATGTCCTCATATGGTGGAAGG - Intergenic
1032139503 7:129314568-129314590 CCATGTCCTTGCATAGTGGAAGG + Intronic
1033276353 7:139974433-139974455 CCACCTTCTCGCTTGGTGGGAGG - Intronic
1034872087 7:154694117-154694139 CTGTGTCCTCGCTTGGTGGAAGG + Intronic
1035290934 7:157838001-157838023 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290944 7:157838057-157838079 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290953 7:157838113-157838135 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290962 7:157838169-157838191 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290971 7:157838225-157838247 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290981 7:157838281-157838303 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290991 7:157838337-157838359 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290999 7:157838393-157838415 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291009 7:157838449-157838471 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291019 7:157838505-157838527 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291029 7:157838561-157838583 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291039 7:157838617-157838639 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291049 7:157838673-157838695 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291059 7:157838729-157838751 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291069 7:157838785-157838807 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291079 7:157838841-157838863 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291089 7:157838897-157838919 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291098 7:157838953-157838975 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291108 7:157839009-157839031 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1036224485 8:6946044-6946066 ACATGTCCTCACTTGGTGGAAGG - Intergenic
1036677548 8:10847510-10847532 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1037759094 8:21730026-21730048 CGAGGGCCTCTCTTGGTGGGAGG + Intronic
1037843083 8:22259433-22259455 CTATGTCCTCACATGGTGGAAGG - Intergenic
1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG + Intronic
1040661706 8:49582696-49582718 CCAGGTCCTCGCTTGGCCCCAGG - Intergenic
1041461768 8:58119360-58119382 CTATGTCCTCGCATGGGGGAAGG + Intronic
1043628653 8:82297264-82297286 CTATGTCCTCCCATGGTGGAAGG + Intergenic
1044174002 8:89094175-89094197 CTACGTCCTCACTTAGTGGAAGG + Intergenic
1045714115 8:105021578-105021600 CCATGTCTTCACATGGTGGAAGG - Intronic
1046897901 8:119493014-119493036 CTATGTCCTCACATGGTGGAAGG - Intergenic
1048355849 8:133653640-133653662 TCAGTTGCTCGCTTGGTGCAGGG + Intergenic
1049635964 8:143689574-143689596 CCAGGTTTTCACTTGGGGGAAGG + Intronic
1050060250 9:1701292-1701314 CAGTGTCCTCGCATGGTGGAAGG - Intergenic
1051701702 9:19831009-19831031 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1055633935 9:78255552-78255574 CCATGTCCTCACATGGTGGAAGG + Intronic
1057042437 9:91857358-91857380 CCAGGTCCCAGCTTGGAGCAAGG + Intronic
1057268197 9:93632567-93632589 CCATGTCCTCATATGGTGGAAGG + Intronic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1059243986 9:112834033-112834055 CAAGGCCCTCGGTTGGGGGAAGG + Intronic
1061249443 9:129417891-129417913 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1062069615 9:134548498-134548520 CTATGTCCTCACATGGTGGAAGG + Intergenic
1062217567 9:135397510-135397532 CCAGGTCCTCGCTGGGTTGTGGG - Intergenic
1062263900 9:135678061-135678083 CCAGGTCCCGTCTTGGTGCAAGG - Intergenic
1185636098 X:1553241-1553263 CCATGTCCTCACATGGTAGAAGG - Intergenic
1185967933 X:4628629-4628651 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1186275311 X:7931975-7931997 CCCTGTCCTCACATGGTGGAAGG + Intergenic
1190302341 X:49064222-49064244 TCAGGGCCTCTCTTGGTGAAGGG - Intronic
1193422321 X:81296141-81296163 GCACGTCCTCGCCTGGTGGCAGG + Intronic
1196407596 X:115380916-115380938 CCGTGTCCTCACATGGTGGAAGG - Intergenic
1197412052 X:126128842-126128864 TCATGTCCTCACATGGTGGAAGG - Intergenic
1198486954 X:137096935-137096957 CCAAGCCCACACTTGGTGGAAGG + Intergenic
1199954248 X:152730509-152730531 CTATGTCCTCGCATGGAGGAAGG - Intronic
1199971668 X:152866216-152866238 CCATGTCCTCACATGGTGGAAGG + Intronic
1200036049 X:153331496-153331518 CCATGTCCTCATATGGTGGAAGG + Intergenic