ID: 1104458106

View in Genome Browser
Species Human (GRCh38)
Location 12:128932155-128932177
Sequence GAGCTAAAGCTTCCCCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104458106 Original CRISPR GAGCTAAAGCTTCCCCAGAC GGG (reversed) Intronic
906346574 1:45019316-45019338 GAGCTCAGGCTCCCCCTGACAGG - Exonic
912040506 1:105383843-105383865 TAGCTAAAGTTTCTCCTGACTGG - Intergenic
916876042 1:168970634-168970656 GAACTTCAGCTTCCCCAGTCTGG + Intergenic
920125514 1:203691124-203691146 TAGCTAAGGCTTCCCCAACCTGG + Intronic
1063357017 10:5410808-5410830 GAACTAAAGCTTCCACAGTGTGG + Intergenic
1063891368 10:10632203-10632225 GATCTAAAACTTCCACACACTGG + Intergenic
1068654697 10:59562799-59562821 GAGGTACAGCTACCCCAGTCTGG - Intergenic
1070815118 10:79318079-79318101 CAGCTAACTCCTCCCCAGACGGG + Intergenic
1071853760 10:89602370-89602392 GAGGTCATGCATCCCCAGACAGG + Intronic
1072607760 10:96998771-96998793 GAGCTTAAGGCTCCCCTGACCGG - Exonic
1080816523 11:35763073-35763095 GAGCTAAAGCTGATCCAGAGTGG - Intronic
1081756185 11:45546387-45546409 TAGCTAAAGCATCCCCTGCCAGG + Intergenic
1083544690 11:63539438-63539460 GAGCTGCAGCTCCCCCAGCCAGG + Intronic
1089638143 11:119829773-119829795 CAGGTACAGATTCCCCAGACTGG + Intergenic
1091361411 11:134981161-134981183 GCTCAAAGGCTTCCCCAGACTGG + Intergenic
1096836230 12:54353070-54353092 GAGCTTCAGTTTCCCCAGCCTGG + Intergenic
1103909491 12:124344537-124344559 GAGGCACAGCTTCTCCAGACAGG + Intronic
1104458106 12:128932155-128932177 GAGCTAAAGCTTCCCCAGACGGG - Intronic
1106594004 13:31121685-31121707 GAGATTAAGCTTTGCCAGACAGG + Intergenic
1111399885 13:87720801-87720823 GAGCTCAAGCATACCCAGAGAGG + Intergenic
1112829155 13:103427462-103427484 AAACTAAAGATTCCCCAGCCAGG + Intergenic
1113946270 13:114045482-114045504 GAGCAAGAGCTGCCCGAGACAGG + Intronic
1117238051 14:53798951-53798973 GAGACAAAGCTTCCAGAGACAGG + Intergenic
1123207263 14:106725635-106725657 AAGCTAGAGGTTCCCCACACGGG + Intergenic
1123212285 14:106772629-106772651 AAGCTAGAGGTTCCCCACACGGG + Intergenic
1131776063 15:95800131-95800153 GGGCTAAAGCTTCCTAAGTCGGG - Intergenic
1133429680 16:5725752-5725774 GAGCTTATGCTTCCCAAGAATGG + Intergenic
1136218665 16:28813061-28813083 GAGCTCAAACTTACCAAGACAGG - Intergenic
1142228543 16:88888833-88888855 GAGCTCCAGCTACCCCACACAGG + Intronic
1146641857 17:34547703-34547725 GGGATCAAGCTTCCCCAGGCAGG - Intergenic
1147253753 17:39169243-39169265 GAACTAAAGCTTCCACAGCGTGG - Intergenic
1148147917 17:45377591-45377613 GAGCTAAAGGTGCCCCAGTGAGG - Intergenic
1148601177 17:48895378-48895400 CAGCTGAGGCTTCCCCAAACGGG - Intronic
1153953703 18:10077966-10077988 GAGCTGAAGCTTCACCAGGAGGG - Intergenic
1154948812 18:21188011-21188033 GAGCTTGAGCTTTCACAGACAGG + Intergenic
1164796776 19:31040006-31040028 GAGCAGATGCTTCCCCAGCCAGG + Intergenic
1165042382 19:33078168-33078190 GAGATAAGACTTCCTCAGACGGG - Intergenic
1167959819 19:53096779-53096801 AAACTAATGCTTCCCCAGGCGGG - Intronic
931226148 2:60333847-60333869 GAGCTAAAGCTGCCCTTGACAGG - Intergenic
932438629 2:71717841-71717863 GAGCCAAAGTTTCCCAAGCCAGG - Intergenic
938212498 2:129480498-129480520 CAGCTAATGCTTCCGGAGACAGG + Intergenic
1172127564 20:32633941-32633963 GAGCTTCAGCTTCCCCACTCCGG + Intergenic
1173727822 20:45309149-45309171 GAGATGAAGCTTCCCCACCCTGG - Intronic
1174650234 20:52118780-52118802 CAGGTAAAGCTTCCTCAGAGAGG + Intronic
1181319311 22:21992216-21992238 GAGCTCATACTGCCCCAGACAGG - Intergenic
1181597126 22:23923179-23923201 GAGCTATAAATTCCCCAGCCTGG - Intergenic
1184876953 22:47282299-47282321 GAGCCAAAGCCTCCACAGAGAGG - Intergenic
955458062 3:59146686-59146708 GGGCAAAAGCTTCTCCACACGGG - Intergenic
960800090 3:121529869-121529891 AAGAAAAAGCTTCCCCAGAAAGG - Intronic
962826950 3:139107399-139107421 GAGCAACAGCTTCCCCAGATAGG + Intronic
962839371 3:139220194-139220216 GAATTAAAGCATCCCCAGGCTGG - Intronic
963977873 3:151503106-151503128 GAACTAAAGGGTCCCCAGGCTGG + Intergenic
968453590 4:686444-686466 GAGTCAAGGCCTCCCCAGACCGG - Intronic
968792494 4:2677029-2677051 GAGCAAAAGCTTCACAACACTGG - Intronic
969887285 4:10226438-10226460 GAGAAAAGGCTTCCCCAGAGAGG + Intergenic
975549858 4:75601968-75601990 GAGCTAAAAATTCCCCAAAAAGG + Intronic
979173309 4:117628948-117628970 GAGCTAAAACTTCACCCTACTGG - Intergenic
981346208 4:143679657-143679679 GAGCTAATTCTTCCCCAGATTGG + Intronic
983734901 4:171044727-171044749 GAGGTAAAGTTTCCTCAAACAGG + Intergenic
989273027 5:39554650-39554672 ATCCTAAAGCTTCCCCACACTGG - Intergenic
990609736 5:57445108-57445130 GAGATAAAACTTCTCCATACAGG + Intergenic
997303112 5:132820652-132820674 CAAATAAAGCTTCCCCAGTCCGG - Intergenic
998143496 5:139712486-139712508 GACCTGAAGTTTCCCCAGAAGGG + Intergenic
998429403 5:142057839-142057861 GAGCCAAAGTTTCCCCAACCTGG + Intergenic
998494617 5:142576974-142576996 TAGCTAAAGGTTCCACAGATAGG - Intergenic
1000679109 5:164160975-164160997 CAGCTATAGCTTACCCAGAGAGG + Intergenic
1000779545 5:165464431-165464453 GAGCTTCAGCTTCCCCAGTGGGG - Intergenic
1004802015 6:19158935-19158957 GAGCTAAGGCTTCCCAAAATTGG - Intergenic
1006097237 6:31663833-31663855 GAGCTAAAGTTTCCCCTTACCGG + Exonic
1007510175 6:42368524-42368546 CCGATAAAGCTTCCCCAAACTGG + Intronic
1016884983 6:148950720-148950742 GAGGTAATGCTTCCCCAGGGAGG - Intronic
1017988437 6:159465427-159465449 CAGCTACAGCATCCCCAGAATGG - Intergenic
1018090619 6:160344755-160344777 GAGCTAAATGTTCCCCAGTAGGG + Intergenic
1018771815 6:166977073-166977095 GAGAAAAATCTTCCCAAGACGGG + Intergenic
1018958888 6:168432202-168432224 AAGCTGAGGCTTCCCCAGAGTGG - Intergenic
1019630576 7:2046807-2046829 GGGCTAGACCTTGCCCAGACAGG + Intronic
1019829065 7:3307928-3307950 GAGTTACAGAATCCCCAGACAGG - Intronic
1030382180 7:108824920-108824942 GAGCCAAAGTTTCCCATGACGGG + Intergenic
1035285883 7:157807017-157807039 AAGCTGATTCTTCCCCAGACTGG + Intronic
1036081977 8:5567171-5567193 GAGGAAAAGCTTCCCCAGCATGG + Intergenic
1038221669 8:25614707-25614729 GAGATAAAGCTTCCAAAGAAAGG - Intergenic
1039185074 8:34907592-34907614 AAGCAAACGCTTCCCCAGAATGG + Intergenic
1041925025 8:63227827-63227849 GAACTATAGCTTCTCCAGACTGG + Intergenic
1047210750 8:122838079-122838101 GGGCTAAAGCACACCCAGACGGG - Intronic
1047446498 8:124924933-124924955 GAGCTACAGCTTTTCCAGTCAGG - Intergenic
1048950842 8:139495600-139495622 GAGCTAAAGCATCTTCAGAAAGG - Intergenic
1052194616 9:25696107-25696129 GAGCTAAAGTTTCCCCAGCAAGG - Intergenic
1052715877 9:32116697-32116719 GAGTTATAGCTTCCCCAGCAAGG - Intergenic
1053144572 9:35703900-35703922 GAGCCAACGCTTTCCCACACAGG - Exonic
1058061134 9:100497188-100497210 GACATAAAGCTTCCACAGCCAGG + Intronic
1061278139 9:129581372-129581394 GAGCTGAAGCTTGCTCTGACGGG + Intergenic
1061357449 9:130117421-130117443 GAACTAAACCCTCCCCAGAAGGG + Intronic
1186496065 X:10014260-10014282 GAGCTTCAGCTTCCCCAGCTGGG + Intergenic
1187830332 X:23374558-23374580 GAGCCAACGCCTCCCCAGAATGG + Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1197967608 X:132081665-132081687 GATTAAAAGCTTCCCCATACAGG - Intronic
1199424941 X:147690563-147690585 GAGCTAAAGCTTCCCATCAGAGG + Intergenic