ID: 1104458292

View in Genome Browser
Species Human (GRCh38)
Location 12:128933273-128933295
Sequence CGCAGGCGGCGCCCGTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104458283_1104458292 25 Left 1104458283 12:128933225-128933247 CCTCAGCCGACGTCACTGAACAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1104458286_1104458292 19 Left 1104458286 12:128933231-128933253 CCGACGTCACTGAACACAGGGTG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104458292 Original CRISPR CGCAGGCGGCGCCCGTGCGC AGG Intronic
900201070 1:1406858-1406880 CGCAGGGGCCGCGAGTGCGCTGG + Intronic
900330363 1:2131219-2131241 TCCAGGCGGCACCCGTGAGCAGG + Intronic
900419504 1:2549636-2549658 CGCAGGCAGGGCCCGTGCTCGGG + Intergenic
900425728 1:2577750-2577772 CGCAGGCAGGGCCCGTGCTCGGG - Intergenic
900512547 1:3067514-3067536 AGCTGGCGGCGGCGGTGCGCTGG - Intergenic
901602144 1:10430667-10430689 CGCGGGGGGCGCCCGGGGGCGGG - Intronic
903218166 1:21854537-21854559 CGGAGGCGGGGCCTGTACGCTGG - Intronic
904783038 1:32964753-32964775 CGTCGGCGGCGGCCGGGCGCTGG - Intergenic
909392929 1:75136443-75136465 CGCCCGCGGCGCCCGGGCTCAGG + Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
921923165 1:220690536-220690558 CGGAGGCGGCGGCCGAGAGCGGG + Exonic
923161358 1:231317486-231317508 TGCACGCGGCGCCCGCGGGCCGG + Intergenic
1062858228 10:790179-790201 CGCAGGAGGGGGCCGTGTGCCGG + Intergenic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1065023200 10:21517336-21517358 CGGCGGCGGCGCCCGGGCGCTGG + Exonic
1066221183 10:33336762-33336784 GGGAGGCGGCGACCGCGCGCGGG - Intergenic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1076059976 10:127406228-127406250 CGCAGGCTGCTCCCTTGCTCTGG - Intronic
1076372232 10:129963297-129963319 GGCAGGCGGTGCCGGTGCGCGGG - Intronic
1076650285 10:131982386-131982408 GGCTGGCGGCGTCCGTGCGGGGG + Intergenic
1076824067 10:132958425-132958447 CACAGGCGGCCTCCGTGCTCCGG - Intergenic
1076985980 11:236370-236392 CGGAGGCGGGGCCGGGGCGCCGG - Exonic
1077043746 11:535496-535518 CGCGGACGGAGCCCATGCGCGGG - Exonic
1083883008 11:65557788-65557810 CGCAGGCGGGGGCGGGGCGCTGG - Exonic
1087014638 11:93543275-93543297 CGGCGGCGGCGCCCGCGGGCAGG - Exonic
1094375447 12:29783891-29783913 CGCAGGCGGCGGCGGAGCGCGGG - Intronic
1095465515 12:42484110-42484132 GGCAGGCGCCGCCCGCGGGCGGG - Intronic
1097085919 12:56468462-56468484 CGTAGGCGACGCCCGGGGGCGGG - Intronic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1103565268 12:121812133-121812155 AGCAGGGGGCGCCCGCGGGCCGG - Intronic
1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG + Intronic
1104568229 12:129903750-129903772 CGCAGGCGGCGCCGGGGTGGCGG + Intergenic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1113779774 13:112969319-112969341 CGCAGGCGCCCCCCGTGCGGAGG + Exonic
1113901307 13:113799843-113799865 CGAAGGCGGCGGCCGCCCGCGGG - Intronic
1116886973 14:50231420-50231442 CGGAGGCGGCGCCGGCGGGCTGG + Exonic
1117377534 14:55129610-55129632 CGCAGGCGGCGGAGGTGCGACGG - Intronic
1117699143 14:58396066-58396088 CGCAGGCGGCGCTTGAACGCGGG - Exonic
1121313679 14:92948783-92948805 CGTGGGCGGCGCCCGGGCGTGGG - Intronic
1121616985 14:95319915-95319937 CGCGGGCGGGGCGCGGGCGCGGG + Intergenic
1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG + Exonic
1122629810 14:103102489-103102511 CGCGTGCGGCGGCCGGGCGCGGG + Exonic
1122630437 14:103105111-103105133 AGCAGGGGGCGCGCGAGCGCCGG + Intronic
1123684502 15:22787210-22787232 CGCAGGAGGCTCCCGGCCGCGGG - Intronic
1124355368 15:28991401-28991423 CGCAGGAGGCGTCCTTGTGCCGG + Intronic
1127257842 15:57306789-57306811 AGCAGGGGGCGCCCCGGCGCTGG - Intergenic
1128651144 15:69414553-69414575 CTCAGGCCGCGGCCGTACGCGGG + Intronic
1129382857 15:75178718-75178740 CACAGGCGGCGGGCGGGCGCGGG - Intergenic
1132252081 15:100341699-100341721 CGCTGACGGCGCCCGAGCGGAGG - Intronic
1132588100 16:714992-715014 CTCCGGCGGCGCCCGAGCTCCGG + Intronic
1133040880 16:3059244-3059266 CGCCGCCGCCGCCCCTGCGCGGG - Exonic
1139418162 16:66831039-66831061 CGCACGCGTCGCCGGTACGCCGG + Intronic
1140364122 16:74368247-74368269 CGCCGGCGGTACCCGTGCCCGGG - Intergenic
1141886213 16:86894226-86894248 CGCAGTCGGTGCCTTTGCGCAGG - Intergenic
1143099813 17:4498906-4498928 CGCAGCCGGGGCCGGAGCGCAGG + Exonic
1143656281 17:8295557-8295579 CGGAGTCGGCGGCCGAGCGCTGG - Intergenic
1144910053 17:18673023-18673045 CGGCGGCGGCGCCCGGGAGCCGG - Exonic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1147588397 17:41666098-41666120 GGGTGGCGGCGCGCGTGCGCAGG - Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1150216991 17:63476641-63476663 CGCAGGCGCCGCTCGTGCGGCGG - Intergenic
1151535486 17:74736879-74736901 AGCAGGCGGCGCCCGAGCCCCGG - Intronic
1152534432 17:80942223-80942245 AGCAGGCAGCCCCCGTGTGCTGG - Intronic
1160164093 18:76495253-76495275 CGCCAGCTGCGCCCGGGCGCGGG + Intergenic
1160775902 19:855612-855634 CCCAGGCGGCGTCCCTGAGCCGG - Exonic
1161036129 19:2085526-2085548 CTCAGGCGCCTCCCGTGCTCTGG - Intronic
1161231995 19:3179068-3179090 GGTAGGCCGCGCCCGTGAGCAGG - Exonic
1161400771 19:4065635-4065657 CGCAGGCCGGGCCCGGGCGTGGG - Intronic
1162099833 19:8333153-8333175 CTCAGGCGGAGCCCGTGGCCAGG - Exonic
1162778694 19:12995763-12995785 GGCAGGCGGCGGCCGCGCTCGGG - Exonic
1162833008 19:13298773-13298795 CCCCGTCCGCGCCCGTGCGCGGG + Exonic
1163464051 19:17455841-17455863 AGCAGGCGGTGCCCAGGCGCTGG + Exonic
1163489029 19:17606212-17606234 AGCAGGCGGCGCTCCCGCGCTGG + Exonic
1164713436 19:30375270-30375292 CGCTCGCGGGGCCCGGGCGCGGG - Intronic
1165307192 19:35010025-35010047 CTCAGCCGGCGCCCGCGGGCTGG - Intronic
1166727803 19:45039261-45039283 CTCAGGCCGAGCCCGTGCCCCGG + Intronic
1166748362 19:45152682-45152704 CGCAGGCGGGGACGGAGCGCGGG - Exonic
1167218627 19:48182660-48182682 AGCAGGCGGCGCACGTCGGCTGG - Exonic
1167376322 19:49114308-49114330 CGCAGGGGGCGCCCGTGGCCCGG + Intronic
929701408 2:44166331-44166353 CGCTGCCGGCGCCCGCGCTCAGG + Intergenic
930008410 2:46915835-46915857 GGCAGGGAGCGCGCGTGCGCAGG - Intronic
931321564 2:61178038-61178060 CGCAGGCGCCTCCCGCGAGCCGG + Exonic
932611416 2:73202864-73202886 CGCAGGCGGAGCCCGACGGCTGG - Exonic
936512201 2:113157458-113157480 CCCAGCCGGCGCCTGGGCGCGGG + Intronic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
941384944 2:164841396-164841418 CGGCGGCGGCGCCCGCGGGCTGG - Exonic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
947527323 2:230886612-230886634 AGCAGGCTGCCCCCGTGCCCCGG - Intergenic
948115823 2:235493979-235494001 GGCAGGCGGGGCGCGGGCGCGGG + Intergenic
948459089 2:238120570-238120592 GGCAGGGGGCGCCCAGGCGCGGG - Intronic
948806040 2:240453730-240453752 CGCAGCCGGAGCGGGTGCGCAGG - Intronic
948857205 2:240735676-240735698 TGCAGGCAGCGCCCGTGCTGGGG + Intronic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
1168965221 20:1894677-1894699 AGCAGCCGGGGCCCGGGCGCCGG + Intronic
1169191436 20:3661056-3661078 CGCACGCGGGGCCCGCGCACGGG + Exonic
1175198468 20:57262634-57262656 GGCAGGCGGCCTGCGTGCGCGGG - Intronic
1176055031 20:63140854-63140876 CACCGGCTGCTCCCGTGCGCGGG + Intergenic
1179912317 21:44456722-44456744 GGCAGGCGGCGCCCAGGTGCAGG - Exonic
1180908397 22:19431658-19431680 CGGCGGCGGCGGCCGAGCGCGGG - Exonic
1181831606 22:25564776-25564798 AGGGGGCGGCGCGCGTGCGCGGG + Intergenic
1182280868 22:29217092-29217114 CCCAGGCGGCCCCCATGCCCTGG - Intronic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184645318 22:45891977-45891999 AGCAGGCTGAGCCCGTGCCCTGG + Intergenic
950345276 3:12287743-12287765 CGCGGGCGGCGGCCGAGCCCGGG + Intronic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
954076832 3:48187907-48187929 AGCAGGCGGCGGCGGTGCGGGGG + Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
955161331 3:56467978-56468000 AGCGAGCGGCGCCCGCGCGCTGG + Intronic
958785629 3:98593703-98593725 CGCCTGCGGCGTCCCTGCGCGGG + Exonic
960884927 3:122384151-122384173 CGCAGGCGGCGCCGGGGGGCGGG - Intergenic
965040306 3:163499206-163499228 CGAGGGCAGCGCCCGTGGGCCGG - Intergenic
968965167 4:3765998-3766020 CGCGGGGGGCGCCCGCGCCCGGG + Intergenic
974036373 4:56821714-56821736 CGCAGGGAGCGCTCGTGCGACGG + Exonic
975131935 4:70839740-70839762 GGCAGGCGGCGCCGGTGCGCCGG + Exonic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
991435747 5:66596210-66596232 GGGAGGCGGGGCCCGGGCGCGGG - Intergenic
992105779 5:73448181-73448203 CGGCGGCGGCGCTCGTACGCCGG - Exonic
998295617 5:140966682-140966704 CGGAGGCGGGGCCCGGGCGTGGG + Exonic
998797468 5:145835269-145835291 CGGAGGCGTGGCCGGTGCGCGGG - Exonic
1002590976 5:180291700-180291722 CGCAGCCGTCGCCCCTGTGCTGG - Intronic
1005864807 6:29929181-29929203 CCCAGGCAGCGACCATGCGCAGG + Intergenic
1007390239 6:41546503-41546525 CGCAGGCGGCGGCGGCGCGGCGG + Exonic
1007531596 6:42547747-42547769 TGCAGGGGGCGCCCTTGCCCAGG - Intergenic
1007533582 6:42564434-42564456 CGCAGGCCGCGCCTGTGGGGAGG + Intronic
1007553597 6:42747624-42747646 CGCAGGCGGGGCGCGGGGGCAGG + Intronic
1007727041 6:43922886-43922908 CGCAGGCAGCGCTCGTGGCCTGG - Intergenic
1013273259 6:108561090-108561112 CGGCGGCGGCGCCCGGGAGCCGG + Exonic
1015244792 6:131063378-131063400 CCCAGGCCCCGCCCCTGCGCGGG + Intergenic
1016433130 6:144008391-144008413 CGCAGGCGGGGCTCGGGAGCCGG + Intronic
1017671909 6:156777533-156777555 CGCAGGCCCCGCCGGAGCGCCGG - Intergenic
1018068357 6:160139686-160139708 CGCTGGTGGCGCCCATGTGCAGG - Exonic
1022814949 7:33905033-33905055 CGCTGGGGGCGCCCGGGCGCAGG - Exonic
1026822132 7:73557133-73557155 CGCAGGCGGGGCCACTGCCCAGG + Intronic
1033033204 7:137846736-137846758 CGCAGGCGGCGCCGCTGCAGGGG + Exonic
1033757007 7:144403902-144403924 AGCAGGCGGCGCCCAGGCCCGGG - Intronic
1035212446 7:157337977-157337999 CGCAGGCGGCACCCCTTCGGTGG - Intronic
1036454135 8:8893192-8893214 CGCAGCCAGCGGCCGAGCGCTGG + Exonic
1036654863 8:10671508-10671530 CACAGGCGGCGCAGGTCCGCAGG + Intronic
1036788281 8:11702156-11702178 CACAGGCGGCGCTCCTACGCCGG - Intronic
1037825258 8:22156682-22156704 CGCAGCCGGCGCCCGAGGGCAGG - Exonic
1041648709 8:60280830-60280852 CGCAGGCGGCGGAAGAGCGCAGG + Intronic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1045564351 8:103298744-103298766 CGCAGGCGGTGCCCGGGCGCAGG + Intronic
1048553983 8:135457628-135457650 CGCCGGCGGCCCCCGCGCTCCGG - Exonic
1059102442 9:111483674-111483696 CGCAGGCGGCGGCGGCGGGCGGG - Intronic
1061472121 9:130835199-130835221 CGCAGGCGGCGGCGGGGCGGGGG + Intronic
1062230675 9:135479980-135480002 CGCAGGCGGGGTCCGCGCGGCGG + Exonic
1186463337 X:9765586-9765608 CGCAGGCAGCGGCAGCGCGCAGG + Exonic
1189234604 X:39477611-39477633 CAGAGGGGGCGCCCGTGAGCTGG + Intergenic
1190246990 X:48697099-48697121 AGGAGGCCGCGCCCGCGCGCGGG + Intronic
1202137088 Y:21676840-21676862 CGAACGCAGCGCCCGTGGGCTGG + Intergenic