ID: 1104463094

View in Genome Browser
Species Human (GRCh38)
Location 12:128970685-128970707
Sequence ATTTGAGGAGGTGCCAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104463094_1104463099 5 Left 1104463094 12:128970685-128970707 CCACGGCTGGCACCTCCTCAAAT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1104463099 12:128970713-128970735 TTGGTTGAAATCACCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 138
1104463094_1104463100 16 Left 1104463094 12:128970685-128970707 CCACGGCTGGCACCTCCTCAAAT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1104463100 12:128970724-128970746 CACCTTGGAAGGACTTTTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1104463094_1104463098 1 Left 1104463094 12:128970685-128970707 CCACGGCTGGCACCTCCTCAAAT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1104463098 12:128970709-128970731 TTTCTTGGTTGAAATCACCTTGG 0: 1
1: 0
2: 1
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104463094 Original CRISPR ATTTGAGGAGGTGCCAGCCG TGG (reversed) Intronic