ID: 1104464702

View in Genome Browser
Species Human (GRCh38)
Location 12:128980740-128980762
Sequence AGCTTTGTGTGGAAGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104464696_1104464702 15 Left 1104464696 12:128980702-128980724 CCAGGGCCGGGGCGCATGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG 0: 1
1: 0
2: 3
3: 39
4: 366
1104464693_1104464702 26 Left 1104464693 12:128980691-128980713 CCTGGTGGTCTCCAGGGCCGGGG 0: 1
1: 0
2: 3
3: 28
4: 304
Right 1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG 0: 1
1: 0
2: 3
3: 39
4: 366
1104464697_1104464702 9 Left 1104464697 12:128980708-128980730 CCGGGGCGCATGGAAGCTATAAG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG 0: 1
1: 0
2: 3
3: 39
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104464702 Original CRISPR AGCTTTGTGTGGAAGGCAGA CGG Intronic
900527800 1:3137590-3137612 GGCTTTGTGTGGATGGAGGAGGG + Intronic
900870221 1:5297075-5297097 AGCTTTGGCTGGAAGGCACGAGG + Intergenic
901757383 1:11449563-11449585 AGCTTTGGGGAGAGGGCAGAGGG - Intergenic
902540411 1:17150220-17150242 GGCTTCCTGTGGCAGGCAGAGGG + Intergenic
903186083 1:21629776-21629798 AGCTTCGTGTGGAAAGCAGGAGG - Intronic
903742775 1:25567819-25567841 AGCCTTGCGTGGAGGGGAGAAGG - Exonic
905565624 1:38962145-38962167 ATCTTTATGAGGGAGGCAGAGGG + Intergenic
905645570 1:39622999-39623021 AGGTTTGTTAGGAAGGCTGAAGG - Intergenic
906073728 1:43036261-43036283 GGCTTTGTTTGGCAGGAAGAGGG + Intergenic
907243454 1:53093079-53093101 AGCTCAGTGGGGAACGCAGAGGG - Intronic
907620709 1:55975515-55975537 TGCTCTGTGTGGTTGGCAGAAGG + Intergenic
910643165 1:89486479-89486501 AGCTTTGGGTAGATGGCAGGAGG + Intergenic
911986534 1:104632669-104632691 AGCTTCCAGTGGAAGGCAAAGGG + Intergenic
912104062 1:106248612-106248634 ACTTTTGGGTGGAAGTCAGAAGG + Intergenic
912799602 1:112712673-112712695 AACTCTGTGTGGAAGCCAGAGGG - Intronic
913407069 1:118506193-118506215 AGTTTAGTGTGGCAGGAAGATGG + Intergenic
915555958 1:156660940-156660962 AGAGTTGTGTGGGGGGCAGAAGG - Intergenic
917460547 1:175225525-175225547 AGCTCTGTGCTGAAGGCTGAGGG - Intergenic
917676307 1:177322294-177322316 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
917984341 1:180299644-180299666 TGCTTTGCGTGGAAGACTGAGGG + Intronic
918128912 1:181608030-181608052 AGCCTGGTGAGGAAGGAAGAGGG + Intronic
918795885 1:188896562-188896584 AGCCTTGTTTGGAAGTCTGATGG + Intergenic
919161991 1:193841886-193841908 ATCCTATTGTGGAAGGCAGAAGG + Intergenic
920457074 1:206109615-206109637 AGCTGTCTGTTGAAGGGAGATGG - Intergenic
921132248 1:212229822-212229844 AGTTTAGCGTGGGAGGCAGATGG + Intergenic
921307944 1:213815861-213815883 AGCTTAGTGAGGAAGGCATGTGG - Intergenic
921370376 1:214416998-214417020 AGCTTTGGGTGGAGGGGAAAAGG + Intronic
923521148 1:234735789-234735811 GCCTTGGTATGGAAGGCAGAAGG - Intergenic
924842246 1:247725047-247725069 AGCTTTGTGTTGATGGGAGGAGG + Intergenic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063074169 10:2698263-2698285 GGCTTTGTTTGGAAAGCAAATGG + Intergenic
1063355983 10:5398651-5398673 AGCTTGCTCTGCAAGGCAGAAGG - Intronic
1063496344 10:6512688-6512710 AGCTTTGTGTGTTGGACAGAAGG - Intronic
1063939988 10:11118455-11118477 AGCTTTGGGGGCAAGGCACATGG - Intronic
1065100067 10:22322568-22322590 AGCTTTTTGTGGAGTGAAGATGG + Intronic
1065289544 10:24215863-24215885 GGCATTGGGTGGAAGGCACAAGG + Intronic
1066043378 10:31575780-31575802 AGCTTAGTGAGGAAGGCATGTGG + Intergenic
1066237913 10:33504902-33504924 GGCTTGGTGAGGAAGGCATATGG - Intergenic
1066270310 10:33816077-33816099 ACCTTTTTCTGCAAGGCAGATGG - Intergenic
1066507922 10:36064926-36064948 ATGTTTGTGTGTAAGGGAGAAGG - Intergenic
1066609812 10:37230849-37230871 AGGTTTGTGTGGAAGACAGAAGG + Intronic
1067182994 10:44004778-44004800 TGGTTTCTGTGGCAGGCAGAGGG - Intergenic
1068303753 10:55177736-55177758 AGCTTTTTCTGGAAGGAAGGTGG - Intronic
1069365053 10:67687756-67687778 AGCTGTTCGAGGAAGGCAGAAGG + Intronic
1069736402 10:70657860-70657882 AGCTTAGTGAGGAAGGCATATGG + Intergenic
1070697159 10:78571968-78571990 AGCTTTGTGTGAGAGGCACCTGG - Intergenic
1070721388 10:78759658-78759680 AGCAATGTGTGGGAGGCACAAGG - Intergenic
1071417458 10:85454548-85454570 AGCTTTATGTGCCAGGCTGAGGG + Intergenic
1072565671 10:96614889-96614911 AGCTTCTAGTGGAAGGGAGATGG + Intronic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1072989269 10:100175343-100175365 ATTTTTATGTGGTAGGCAGAGGG + Intronic
1073361987 10:102907157-102907179 AGCATTGTGAGGGAGGCATAAGG - Intergenic
1075559769 10:123460169-123460191 AGTTTTGTGTTGAAGGCTGAGGG + Intergenic
1076075748 10:127532581-127532603 AGCTCTGGGAGGAAGGCAGGGGG - Intergenic
1077948222 11:6926133-6926155 AGTTTTGTATGGAAGTGAGAGGG - Intergenic
1078907683 11:15703038-15703060 TGCTTTGTGGGGAATGCAAAAGG - Intergenic
1081488833 11:43551323-43551345 AGCTTAGTGAGCAAAGCAGAGGG - Intergenic
1081600987 11:44494024-44494046 AGCTTTGAGTGGGAGCCAGCAGG + Intergenic
1081651076 11:44824539-44824561 AGCTTTGTTTGGAGGTCACAGGG - Intronic
1081654937 11:44850903-44850925 ACCCTGGAGTGGAAGGCAGAGGG - Intronic
1081704106 11:45170680-45170702 GGTTTTGAGTGGAGGGCAGAGGG + Intronic
1081815080 11:45934521-45934543 ACCTTTGTTTGGAAGTCTGATGG - Intronic
1081868931 11:46374587-46374609 AGCTGTCTGTGGGAGACAGAGGG - Exonic
1082906096 11:58310013-58310035 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1083901327 11:65644934-65644956 AGCTGTGGGTGGGAGACAGAAGG - Exonic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1084981204 11:72829717-72829739 AGCTCTGTATGGAAGGAGGAAGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086562267 11:88181452-88181474 AGGTCAGAGTGGAAGGCAGAAGG - Intergenic
1087194564 11:95292536-95292558 AGCTTTGTGAGGCAGGGACAGGG + Intergenic
1088904526 11:114144286-114144308 AGCTTTGTGTGAAAAGGACAGGG - Intronic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1089415272 11:118283923-118283945 AGCTTAGTGAGGAAGGCATATGG + Intergenic
1089823737 11:121252552-121252574 AGCTTAGTGAGGAAGGCATGTGG + Intergenic
1090905012 11:131067361-131067383 AGCCTGGTGTGAAAGCCAGAGGG + Intergenic
1093704767 12:22262386-22262408 TGCTTTGTGTGGATTGCACAAGG - Intronic
1094112508 12:26876550-26876572 AGCTTAGTGAGGAAGGCATGTGG + Intergenic
1094276653 12:28684750-28684772 AGTTTTGTGTGGAAGGAATTTGG - Intergenic
1095284742 12:40395546-40395568 AGCTTAGTGAGGAAGGCATGTGG - Intronic
1095933044 12:47648597-47648619 AGCTGTGTTTGGAAGGCTAACGG + Intergenic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1100163669 12:91892278-91892300 AGCTCTGTGTGATAGGGAGAGGG + Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1102397806 12:112602290-112602312 GGCTTTGTTAGAAAGGCAGAGGG - Intronic
1103034955 12:117649071-117649093 AGTTTTGTGAGGTATGCAGATGG + Intronic
1103163875 12:118753546-118753568 AGCTTTGGGTTGAAGGCAGATGG + Intergenic
1103177544 12:118877743-118877765 AGCTTTGTGGGGAGATCAGAGGG - Intergenic
1103818427 12:123677741-123677763 AGCTGTAGGTGGAAGACAGAGGG - Intronic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104488404 12:129172474-129172496 AGCTGAGTGAGGAAGGCAGATGG - Intronic
1104629802 12:130390948-130390970 AACTATGTGGGGAAGGCAGGAGG - Intergenic
1104778307 12:131404077-131404099 AGCTTTCTGAAGAAGACAGAGGG + Intergenic
1105423628 13:20274600-20274622 AACTTTCTGTGGAATGCAAAGGG + Intergenic
1106182492 13:27381192-27381214 GGCTTTGTCTGGATGGCTGAAGG + Intergenic
1106806725 13:33316149-33316171 AGGTTGGAGAGGAAGGCAGAAGG - Intronic
1108394685 13:49980855-49980877 CCCATTGTGTGGAAGGAAGATGG - Intergenic
1109401786 13:61840712-61840734 AGCTTCGTCTGGAATGCAAAAGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110808650 13:79788743-79788765 AGCTCTGTGTGTCAGGCTGAAGG - Intergenic
1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG + Intergenic
1112468206 13:99663709-99663731 ACCTTTGTGCGGAAGCCAGCTGG + Intronic
1113753975 13:112796249-112796271 AACCTAGTGTGGCAGGCAGAAGG + Intronic
1113758771 13:112833123-112833145 AGCTCAGTGTGGAGGGCACAGGG - Intronic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1114861431 14:26528076-26528098 AGGTTTGAGGGGAAGGGAGAAGG + Intronic
1116246693 14:42424243-42424265 TGTCTTCTGTGGAAGGCAGAAGG + Intergenic
1116932395 14:50703094-50703116 AGCTGTGTGTGTCAGTCAGAAGG + Intergenic
1118085792 14:62415034-62415056 AGGTTTGTGTGGAAGGGCAAAGG + Intergenic
1118637043 14:67757426-67757448 AGATCTATGGGGAAGGCAGAGGG - Intronic
1118972127 14:70645798-70645820 AGCTTTGTGTAGAAGGAGGATGG - Intronic
1119350932 14:73965027-73965049 AGCATTTTGAGGAAGGCAGTTGG + Exonic
1121123476 14:91391059-91391081 CGCTTGGTGTTGAAGGCAGTGGG - Intronic
1122266730 14:100550181-100550203 GGCTCTCGGTGGAAGGCAGAAGG - Intronic
1122780013 14:104139565-104139587 AGGTTTGTGTGGGAGGAGGAGGG + Intronic
1122838029 14:104440657-104440679 ACCTCTGTGAGGAAGGCAGGTGG - Intergenic
1124244087 15:28055594-28055616 AGCTATGTGTGGAATGCTGTGGG + Intronic
1124327469 15:28779921-28779943 AGCTGTGTGTGTAAGGGAGTAGG + Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125160800 15:36641340-36641362 AGCACTGTGAGGATGGCAGACGG - Intronic
1125626334 15:41112218-41112240 ATATTTTTGGGGAAGGCAGAAGG + Intronic
1126539549 15:49806540-49806562 AGCTTGGAGTGAAAAGCAGAAGG - Intergenic
1127111649 15:55679364-55679386 CGATTTGTGTGTCAGGCAGAAGG - Exonic
1131635896 15:94232381-94232403 AGCTTGGTCTGGAAGGTACAAGG + Intronic
1131707608 15:95015092-95015114 ACCTTTGTGTGCCAGGCTGAAGG + Intergenic
1132293459 15:100719011-100719033 AGCTATGTGGAGAAGGCAAATGG + Intergenic
1132386640 15:101405421-101405443 AGTGTTGAGTGGAAGGAAGATGG + Intronic
1132513591 16:355418-355440 AGCTCTGTGAGGAAGGGAGGTGG - Intergenic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1136406615 16:30051848-30051870 AGGTTTGAGGGGAAGACAGAGGG + Intronic
1136412670 16:30086189-30086211 AGGTTTGTGATGGAGGCAGAGGG + Exonic
1138594618 16:58023198-58023220 AGCTTTGTTTCCAAGGGAGAGGG + Intergenic
1139878117 16:70162827-70162849 AGGTTTGTGTGGAAAGCAAGGGG + Intergenic
1141036723 16:80633077-80633099 ATCGTTGTGCGGAAGGAAGAAGG - Exonic
1141378176 16:83550894-83550916 AGCTTGGTGGGGAAGAGAGAGGG - Intronic
1141439754 16:84022348-84022370 AACTGTGTGTGGGAGGCAGAGGG - Intronic
1141663980 16:85456407-85456429 AGCATAATCTGGAAGGCAGAGGG - Intergenic
1142732665 17:1871915-1871937 TGCTTTGTTTGGGAGGGAGAGGG + Intronic
1144675175 17:17157397-17157419 GGCTTGGAGAGGAAGGCAGAAGG - Intronic
1145245219 17:21264689-21264711 AGCTCTGGGCAGAAGGCAGATGG - Intergenic
1146642600 17:34552644-34552666 AGCTTTGTTCTGGAGGCAGATGG + Intergenic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147268319 17:39248297-39248319 AGCTTTGTGTCAAGGGGAGAGGG + Intergenic
1147306271 17:39566607-39566629 AGCCTTCTGTGGCAGACAGATGG + Intergenic
1148734902 17:49859897-49859919 AGCACTTTGTGGAAGGCTGAGGG - Intergenic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149845572 17:60007553-60007575 AGACATGAGTGGAAGGCAGAGGG + Intergenic
1151347916 17:73514617-73514639 AGCTTATTCTGGAGGGCAGATGG - Intronic
1151568052 17:74911016-74911038 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1153253996 18:3152139-3152161 GGCCTTGTGTAGAAAGCAGAGGG + Intronic
1153438091 18:5088116-5088138 AGCTGTTCGAGGAAGGCAGAAGG - Intergenic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1156499341 18:37547274-37547296 AGCCTTGGGTGGACGGCTGAGGG + Intronic
1156567334 18:38208188-38208210 AGCCTTGAGTTGAAGGCAGAGGG - Intergenic
1156596954 18:38558491-38558513 GGCTATGTGGGAAAGGCAGAAGG + Intergenic
1159871010 18:73759688-73759710 ACCTTTGTGTGAAAGGAAGGAGG + Intergenic
1160520723 18:79506457-79506479 AGGGCTGTGTGGAGGGCAGACGG - Intronic
1162006544 19:7784032-7784054 AGCTTAGTGAGGAAGCCAGAAGG - Intergenic
1163078167 19:14915107-14915129 AGAAGTGTGTGCAAGGCAGAAGG - Intergenic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163574578 19:18103107-18103129 AGCTGTGGGTGGAAAGCAGATGG + Intronic
1164719979 19:30424905-30424927 AGCGTTGGGTGGGAAGCAGAAGG - Intronic
1164922299 19:32097544-32097566 AGCTTGGTCTGGGATGCAGAGGG - Intergenic
1165099552 19:33430867-33430889 AGCTCTGTGTGCGTGGCAGACGG - Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166253601 19:41587163-41587185 ACCTTTGTGTGGACATCAGATGG - Intronic
1166410418 19:42552824-42552846 ACCTTTGTGTGGACATCAGATGG + Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168176753 19:54632407-54632429 AGATTTGTGGGGAAGCCTGAGGG + Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
925784465 2:7417563-7417585 AACTCTGGGTGGAAAGCAGAAGG - Intergenic
926477229 2:13339086-13339108 ATCTATTTGTGGAAGACAGAAGG + Intergenic
927448505 2:23186659-23186681 AGCTTCTTGTTGAAGGCAAAAGG + Intergenic
928019208 2:27688236-27688258 TGCTTTGTGGGGGAGGGAGAGGG - Intronic
928979052 2:37119398-37119420 AGCTTTATTTGAGAGGCAGAGGG - Intronic
929005634 2:37390384-37390406 AGAATTGGGTGGAGGGCAGAAGG + Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929843418 2:45495917-45495939 TGCTTTGTGGGGATGGCAGGTGG - Intronic
929889397 2:45906686-45906708 TGCTCTGTGTGGGAGGCAGCAGG + Intronic
930555992 2:52896300-52896322 GGCATTCTGGGGAAGGCAGATGG - Intergenic
931960982 2:67482598-67482620 AGCTTAGTGAGGAAGGCATGTGG + Intergenic
932708922 2:74047855-74047877 AGCCCTGTGAGGCAGGCAGAGGG - Exonic
932750781 2:74370350-74370372 AGGGATGTGAGGAAGGCAGAAGG + Intronic
932975535 2:76595633-76595655 GGATTTGTGAGGAAGGAAGAAGG + Intergenic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
934545718 2:95213785-95213807 AGATTTTTGTGAAAGGGAGATGG + Intronic
934573274 2:95385091-95385113 TGCTTTTTGTGCAAGGCAGAGGG - Exonic
935684129 2:105668723-105668745 AGCTTCATGTGAAAGGAAGAAGG + Intergenic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
936921549 2:117694193-117694215 AACTAGGTGTGGAAGGGAGAAGG - Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937295353 2:120806817-120806839 AGCTCTGTGTGGACACCAGAGGG + Intronic
939121883 2:138126962-138126984 AAGTTGGTGTTGAAGGCAGAAGG + Intergenic
941107211 2:161368597-161368619 TGCTTTTTTTGGAAGGTAGATGG - Intronic
942524190 2:176835915-176835937 AGGTTTGTGGGGAAGGGAGTGGG - Intergenic
942539930 2:177005381-177005403 AGCATAGTGAGGAAGGCACATGG + Intergenic
942708627 2:178805579-178805601 AGCTTTTTGTAGACGGCATACGG + Intronic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
946643302 2:221807141-221807163 AGCTTTTTGTGGAGGGAAGTAGG - Intergenic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
948200890 2:236129074-236129096 AGCTTTTTGGGGAAGGATGAGGG - Exonic
948710448 2:239821866-239821888 GGCTCTGGCTGGAAGGCAGAGGG + Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1169532769 20:6503347-6503369 AACTTTGTCTGGAAGGCTCAAGG - Intergenic
1170028664 20:11919994-11920016 AGCTTTCCGTGGAAAGCATATGG + Intronic
1170095723 20:12643864-12643886 AGGTTACTGAGGAAGGCAGAAGG - Intergenic
1170360768 20:15543756-15543778 AGCTGTGTCTGGAAGTCAGCTGG + Intronic
1170444814 20:16415547-16415569 AATTTTCTGTGGAAAGCAGAAGG - Intronic
1171237340 20:23537954-23537976 AAATTTGTGTGGTAGGCAGATGG - Intergenic
1172110930 20:32544468-32544490 AGCTTTGTCCTGAAGGCAGTGGG + Intronic
1172320620 20:33993310-33993332 AGCTTAGAGTGGGAGGAAGATGG - Intergenic
1172623397 20:36334070-36334092 AGCTCTGTGTGCCAGGCACAGGG + Intronic
1174004280 20:47398064-47398086 AGCATTGAGTGGCAGCCAGAAGG - Intergenic
1174546255 20:51327640-51327662 AGCTCTGTGTCGTAGGCACACGG - Intergenic
1175649714 20:60708963-60708985 AGCTTAGTGAGGAAGGCATGTGG + Intergenic
1177833846 21:26169768-26169790 AGCTCTGTCTGAGAGGCAGAAGG - Intronic
1177956616 21:27606313-27606335 AGCTTAGTGTGTTAGGCAGCTGG + Intergenic
1178587892 21:33885253-33885275 AGCTTGGGGTGGGATGCAGATGG + Intronic
1179791054 21:43756276-43756298 AGCCTTGTGGGGAAGGGAGCCGG - Exonic
1180021658 21:45132331-45132353 AGCTTTGTGAGGAACTAAGATGG + Intronic
1181392778 22:22595574-22595596 AGCTTTGGGTGTATGGCGGATGG - Intergenic
1182771115 22:32797009-32797031 AGCTTTGTGGCCATGGCAGATGG + Intronic
1183776777 22:39971312-39971334 AGGGGTGTGTGGAAGGCAGTGGG + Exonic
1184117858 22:42432425-42432447 AGCTTCGTGGGGAAAGCAAAGGG - Intergenic
1185089326 22:48757054-48757076 TGCTTTGTGAGGAAATCAGAAGG + Intronic
949755580 3:7406979-7407001 AGCATAGTGTGGAAGGAGGAAGG + Intronic
950741155 3:15052669-15052691 AACTTTGAGTGGCAGGCACAGGG + Intronic
951219526 3:20054626-20054648 AGGTTTGTGTGGTATGCAGGAGG + Intronic
951239496 3:20272343-20272365 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
952521018 3:34157857-34157879 AGCTTTGTGAGGAATGTAGGTGG + Intergenic
954831177 3:53422509-53422531 AGCTAAGTGTGAAAGCCAGATGG - Intergenic
954946006 3:54424920-54424942 AGCTCTGTGAGCAAAGCAGATGG - Intronic
954980408 3:54740575-54740597 AGCTCTTTGTGGAAGGGGGAAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956996594 3:74832786-74832808 AGCATTGTGAGGAATACAGAGGG - Intergenic
959605539 3:108237360-108237382 AGCTTTGTGTGTCAGACTGAAGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
960834305 3:121889087-121889109 AGGTTTGACTGGGAGGCAGAAGG + Intergenic
961108694 3:124264732-124264754 AGAAATGTGTGGATGGCAGAAGG - Intronic
961824745 3:129593114-129593136 AGCTTTGTGTGAGAGAAAGATGG - Intronic
962805986 3:138928277-138928299 AGGTGTGTGTGGAAGGCATGCGG + Intergenic
962924454 3:139978699-139978721 TGTGTTGTGTGGAAGGGAGAGGG + Intronic
963056868 3:141193332-141193354 AGCTTCGTGTGTCAGGCTGAAGG - Intergenic
963773236 3:149411012-149411034 AGCTTAGTGACGAAGGCATATGG - Intergenic
964315081 3:155434906-155434928 AGCCTTGTGAGGAATGAAGAGGG - Intronic
966153192 3:176888483-176888505 AGCTTTGTGAGGAATACAGTGGG + Intergenic
967154324 3:186678699-186678721 AACTTTGTGTGGAAAGTAGCAGG - Intergenic
967199550 3:187060037-187060059 AGTTTTGTGTGGAAGGAAATGGG + Intronic
969280015 4:6163629-6163651 AGCTTCATGAGGAAGGCAGGTGG + Intronic
969845513 4:9917218-9917240 AGCCTATTGTGTAAGGCAGAGGG + Intronic
970339800 4:15093966-15093988 AGCTTTGGGAGGAAAGCACACGG + Intergenic
970356298 4:15256557-15256579 AGTTCTGTGTGGAAGTCAAAGGG - Intergenic
970775324 4:19668056-19668078 TGCTCTGTGTGAAAGGCACAGGG + Intergenic
971238802 4:24868823-24868845 AGCTCTGAGTGGACTGCAGAGGG + Intronic
971859587 4:32087239-32087261 AGCTTCCTCTGGAAGGAAGATGG + Intergenic
972195070 4:36644665-36644687 AGATGTGTGTGGGAGCCAGAAGG - Intergenic
972666215 4:41167624-41167646 AGCATTGTATGGAAGTCATATGG + Intronic
973090807 4:46133862-46133884 TGCTTTGTATAGAAGGCAGATGG + Intergenic
975048014 4:69827508-69827530 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
976174298 4:82336372-82336394 AGCCTCTTGAGGAAGGCAGAAGG + Intergenic
978285115 4:107068402-107068424 AGATTTGTGTGGGGGGAAGAGGG - Intronic
978516599 4:109575246-109575268 TCCTTGGTGGGGAAGGCAGATGG - Intronic
980079949 4:128333720-128333742 AGATTTCTGTGCCAGGCAGAAGG + Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
980892928 4:138833873-138833895 AGATCTCTGTGGAAGACAGATGG - Intergenic
981163879 4:141533667-141533689 AGCTTTTTGTAGAGGGTAGAGGG - Intergenic
981537863 4:145819013-145819035 AGCTTTTTTTGGTAGGCAGGGGG - Intronic
981898400 4:149832845-149832867 AGCTTAGTGAGGAAGGCATGTGG - Intergenic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985110994 4:186546362-186546384 AGCCGTGTGTGGAAGGGGGAGGG - Intronic
987272396 5:16325295-16325317 AGAATTATGTGCAAGGCAGAGGG - Intergenic
987568751 5:19627944-19627966 AGCTTTGTTTGTAAGTAAGATGG + Intronic
987834730 5:23146348-23146370 AGCTTAGTGTGTTAGGCAGTTGG + Intergenic
989497639 5:42127242-42127264 ACCACTGTGTGGATGGCAGAAGG + Intergenic
990116749 5:52399968-52399990 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
990188252 5:53230649-53230671 AGCCTTTTGAGGAAGGCAGTAGG + Intergenic
990716252 5:58640355-58640377 AGGTTTGGGGGAAAGGCAGAGGG - Intronic
990942055 5:61212790-61212812 AACTCTGTGTGGAAGTCAGGAGG + Intergenic
991944775 5:71889499-71889521 AGCTATCTGTGGAAAGCACATGG - Intergenic
992492008 5:77254541-77254563 CCCTTTGTGAGAAAGGCAGAAGG - Intronic
992564785 5:77986439-77986461 AGCTTTGTGTGGACACCAGCAGG - Intergenic
993012496 5:82499290-82499312 AGCTAAGTGTGAAAGCCAGAGGG + Intergenic
994231716 5:97315594-97315616 AGCTGCTTGAGGAAGGCAGAGGG + Intergenic
994253213 5:97561698-97561720 AGCTCTTAGTGGAAGGCATAGGG + Intergenic
994319848 5:98381439-98381461 AGGTTTGATTGGAAGGGAGAAGG - Intergenic
996883323 5:128326220-128326242 AGCTTTATGTGGAAGATAGCTGG + Intronic
997072412 5:130636269-130636291 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
997459347 5:134041713-134041735 CGCCCTGTGTGGAAGGCAGGAGG - Intergenic
998632471 5:143915109-143915131 GGCTTTCTGTGGGAGGCAGCTGG - Intergenic
998845697 5:146307542-146307564 AGCTTTGTTTGGAAGGATGGAGG + Intronic
999211785 5:149895933-149895955 AGGTATGTGTGGGAGGCAGTGGG - Intronic
1000018922 5:157302317-157302339 AGCATTGTATGGAAAACAGAAGG - Intronic
1000288545 5:159848308-159848330 GGCTTTTTGGGGAAGGCAGAAGG + Intergenic
1000532320 5:162438534-162438556 AGCTTAGTGAGGAAGGCAGGTGG + Intergenic
1000583711 5:163067534-163067556 ATCTTTGCGTGGATGGCATATGG - Intergenic
1001684195 5:173580929-173580951 AGCTTTGTGCAGCAGCCAGAGGG - Intergenic
1002342793 5:178527712-178527734 AGCTTGTAGTGGAAGGCAGTGGG - Intronic
1003148674 6:3530453-3530475 AGCTGTGGCTGGAAGGAAGAGGG + Intergenic
1003805801 6:9724971-9724993 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
1005402226 6:25446733-25446755 AGCTTAGTGAGAAAGGCACATGG - Intronic
1005409922 6:25533661-25533683 AGAGTTGTGTAGAAAGCAGAAGG - Intronic
1006389745 6:33751395-33751417 AACTCTCTCTGGAAGGCAGATGG + Intergenic
1008622522 6:53285109-53285131 AGCTTAGTGAGGAAGGCAGGTGG + Intronic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1008911145 6:56734831-56734853 AGGTTTATGTGGATGGCAGAAGG - Intronic
1012472330 6:99586372-99586394 AGCTTAGTGAGGAAGGCATGTGG - Intergenic
1012695348 6:102374835-102374857 AGTTTAGTGAGGAAGGCATATGG + Intergenic
1013374022 6:109496709-109496731 AGTTATGTGGGGAAGGCAGCGGG - Intronic
1013378834 6:109546058-109546080 AACTATGTGTGGAAGACAGTTGG - Exonic
1013968426 6:115984720-115984742 GACTTTGTGTGAATGGCAGAGGG - Intronic
1014103401 6:117536712-117536734 AGATCTGTGGGGAAGGCAGATGG + Intronic
1014182520 6:118400814-118400836 TGCTTTGTGTGAAAGGCATATGG + Intergenic
1014576332 6:123078593-123078615 AGCTTTAAGTGGAAACCAGAGGG - Intergenic
1016041980 6:139441122-139441144 AGTTTTCTGTGGAAATCAGATGG - Intergenic
1016208107 6:141495142-141495164 AGCTTTGGTAGGAAGGCAAAAGG - Intergenic
1016594609 6:145785383-145785405 TGCTTTGTGTGGAAGGAGAAAGG + Intergenic
1018977984 6:168579998-168580020 AGGTTAGTGTGGGAGGCAAATGG + Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1020914311 7:14172846-14172868 AGCTTGGGGTGGAGGGTAGAGGG - Intronic
1020976423 7:15012594-15012616 AACGTTGTGAGGATGGCAGAAGG + Intergenic
1021356576 7:19658368-19658390 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1021430882 7:20557448-20557470 AGCTCTGCTTAGAAGGCAGATGG + Intergenic
1021667129 7:22995188-22995210 AGCTTTGGGTGGATGGTTGAAGG - Intronic
1021677083 7:23091450-23091472 AGCTACGTGAGGAAGGGAGATGG - Intergenic
1021717950 7:23476667-23476689 TGCTCAGTGTGGAAGGAAGAGGG + Intergenic
1021785294 7:24145405-24145427 TGCTGTTTGTGTAAGGCAGAAGG - Intergenic
1022983020 7:35622616-35622638 AGCTCAGTGTGGAAGGCAGGTGG + Intergenic
1023182500 7:37499156-37499178 AGCTTTATTAGGAAGGAAGACGG + Intergenic
1023635785 7:42208818-42208840 AGATGTGTGTGGCAGCCAGAAGG - Intronic
1023857905 7:44196489-44196511 AACTTTCAGTGGAAGGAAGAGGG + Intronic
1027085693 7:75262291-75262313 AGCTTTTTGTGTTAGGGAGAAGG - Intergenic
1027648550 7:80836251-80836273 AGCTTCATGTAGAAGACAGAAGG + Intronic
1028713179 7:93934387-93934409 AGGGGTGGGTGGAAGGCAGAGGG - Intergenic
1029100987 7:98129904-98129926 AGCCTAGTGGGGAAGGCATATGG + Intronic
1029157211 7:98525838-98525860 AGGTTTGTGTGGATGGCACTTGG + Intergenic
1030550392 7:110951681-110951703 AGCTTTGTATGGAACACAGCAGG + Intronic
1030827014 7:114170458-114170480 AGTTTTGTGAGGAAGGCATGTGG + Intronic
1031788207 7:126062026-126062048 ATTTTTGTGTGAAAGGGAGAGGG + Intergenic
1031851550 7:126870437-126870459 AGCTTAATGAGGAAGGCACATGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032235500 7:130118633-130118655 AGCTTAGTGAGGAAGGCATGTGG - Intronic
1032524027 7:132565701-132565723 AGCTTTGGGAGGAAGACAGGTGG - Intronic
1034582775 7:152060437-152060459 AGCTTAGTGAGGAAGGCATGTGG - Intronic
1034627501 7:152504668-152504690 AGCTAATTGTGGAAGGCAGCTGG - Intergenic
1034721972 7:153301677-153301699 AGCTTGGTCTGGAAGGAAAACGG + Intergenic
1035214553 7:157355502-157355524 AGCTGGTGGTGGAAGGCAGATGG + Intronic
1037001625 8:13726376-13726398 AGGTTTCTTTGGAAGGCAGCTGG - Intergenic
1037458537 8:19086087-19086109 CTCATTGGGTGGAAGGCAGAAGG - Intergenic
1037637274 8:20711257-20711279 AGCATTGTGGGGAAGGCTGGTGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039702781 8:39978955-39978977 ACCTTTGGGTGGAAGGCAATGGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040575984 8:48651944-48651966 AGGTCTGTGTGGAAAACAGAGGG + Intergenic
1040961452 8:53037864-53037886 AGCTGTTTGTAGAAGGCATATGG + Intergenic
1041055421 8:53980813-53980835 AGTTTAGTGAGGAAGGCATATGG + Intronic
1041732044 8:61072194-61072216 AGCTGGGTGTTGAAGGCAGCGGG - Intronic
1041958690 8:63586139-63586161 AGCTTTCTTTGGAAAGCAGTGGG + Intergenic
1042046734 8:64661606-64661628 AAATTTGTGTGGAAAGTAGAGGG + Intronic
1042077593 8:65013503-65013525 GGCTTTTGGTGGAAGGCAAAAGG - Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043257056 8:78150251-78150273 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044008414 8:86964166-86964188 AGATTTCTGAGGAAGGCAGTGGG + Intronic
1045858552 8:106791233-106791255 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1046263319 8:111799435-111799457 AGCTATGTGTGAAAGCCAGAGGG + Intergenic
1046537273 8:115531560-115531582 AGGCTAGTGTGGAAGTCAGAAGG + Intronic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1047723893 8:127668116-127668138 AGGTTTGTGTGGCATGCTGAAGG - Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049620595 8:143596728-143596750 GGCTTTAAGTGGAAGGAAGAAGG - Intronic
1051161043 9:14207614-14207636 AGGTTTGTGGGGAAGGAGGAAGG - Intronic
1052448345 9:28592486-28592508 AGCTTTGTGTTGTAGCGAGATGG + Intronic
1053399153 9:37801586-37801608 AGCTTTTTGAGGCAGGCAGGCGG + Intronic
1053481553 9:38420173-38420195 AGCCTTGGGTGCAAGGCCGAAGG - Intronic
1053661343 9:40283653-40283675 AGGGGTGTGTGGAAGGCAGAAGG + Intronic
1053911718 9:42912999-42913021 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054373462 9:64429871-64429893 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054523267 9:66092631-66092653 AGGGGTGTGTGGAAGGCAGAAGG - Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1054916005 9:70495899-70495921 ACCTTAGTATGCAAGGCAGAAGG - Intergenic
1055030049 9:71764979-71765001 AGCTTGGCTTGGGAGGCAGAGGG + Intronic
1056386543 9:86101570-86101592 AGCCTGTGGTGGAAGGCAGAAGG + Intergenic
1056472899 9:86923428-86923450 ATCTCATTGTGGAAGGCAGAAGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1058846130 9:108961223-108961245 ACCTTTGTATGGAAAGCAGTGGG + Intronic
1060098097 9:120811941-120811963 TGTTTTTTGTGGAAGGCTGAAGG + Intergenic
1061216390 9:129224360-129224382 TGCTCTGTGAGGAAGGCAGGGGG + Intergenic
1062657482 9:137611811-137611833 TGCTCTGGGTGGCAGGCAGAAGG + Intronic
1185644010 X:1604212-1604234 AGCTGTGTGCGCAAGACAGAAGG + Intergenic
1186969851 X:14829950-14829972 AGCTTAGTGAGGAAGGCAGTTGG - Intergenic
1187908786 X:24091373-24091395 AGCTTAGTGAGGAAGGCATGTGG - Intergenic
1190438726 X:50454575-50454597 AGCTTTGAGAGAAAGGCAGAGGG - Intronic
1192370893 X:70512095-70512117 AGCTTTGTGTGAGGGGCAGTGGG - Intergenic
1192754542 X:74033654-74033676 AACTTAGTGAGGAAGGCACATGG + Intergenic
1193274656 X:79571097-79571119 AGCTCTGTGTGTCAGACAGAAGG + Intergenic
1193861664 X:86675075-86675097 ATCTTTGGTTGGGAGGCAGAGGG - Intronic
1194238569 X:91415003-91415025 AACGCTGTTTGGAAGGCAGAAGG - Intergenic
1194621967 X:96184026-96184048 AGCTCTTTGTGGACAGCAGATGG + Intergenic
1194867339 X:99085577-99085599 AGCTTTGTGTGTCAGACTGAAGG - Intergenic
1194970792 X:100341341-100341363 GGTTTTGTGTGGAAGCTAGAGGG + Intronic
1195095621 X:101498577-101498599 AGCTATGTTTGAAAGTCAGATGG + Intronic
1195656546 X:107336753-107336775 TGCTTGGTATGGAAGGAAGAGGG + Intergenic
1197700800 X:129598065-129598087 AGCTTTGCATGCCAGGCAGAAGG - Intergenic
1198648812 X:138838396-138838418 AGCTCTGTGTGTCAGGCTGAAGG + Intronic
1199985410 X:152946678-152946700 AGCTGGGTTTGGAAGGCTGAGGG + Intronic
1200521175 Y:4211132-4211154 TGCTTTGTGCAGAAGACAGATGG + Intergenic