ID: 1104465091

View in Genome Browser
Species Human (GRCh38)
Location 12:128983790-128983812
Sequence GCCTCCATCTCAGGGTCACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104465091_1104465101 1 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465101 12:128983814-128983836 TGAGGCTTTGGGTCCAGGGTGGG 0: 1
1: 0
2: 1
3: 29
4: 320
1104465091_1104465104 24 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465104 12:128983837-128983859 CTCTTCCCCTTCCCACATCAGGG 0: 1
1: 1
2: 3
3: 30
4: 386
1104465091_1104465096 -10 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465096 12:128983803-128983825 AGATGGAGGCCTGAGGCTTTGGG 0: 1
1: 0
2: 1
3: 26
4: 276
1104465091_1104465107 30 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465107 12:128983843-128983865 CCCTTCCCACATCAGGGACCCGG 0: 1
1: 0
2: 2
3: 26
4: 242
1104465091_1104465097 -4 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465097 12:128983809-128983831 AGGCCTGAGGCTTTGGGTCCAGG 0: 1
1: 0
2: 3
3: 38
4: 350
1104465091_1104465103 23 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465103 12:128983836-128983858 GCTCTTCCCCTTCCCACATCAGG 0: 1
1: 0
2: 0
3: 28
4: 280
1104465091_1104465098 -3 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465098 12:128983810-128983832 GGCCTGAGGCTTTGGGTCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 268
1104465091_1104465100 0 Left 1104465091 12:128983790-128983812 CCGCGTGACCCTGAGATGGAGGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1104465100 12:128983813-128983835 CTGAGGCTTTGGGTCCAGGGTGG 0: 1
1: 0
2: 1
3: 42
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104465091 Original CRISPR GCCTCCATCTCAGGGTCACG CGG (reversed) Exonic
900521696 1:3108704-3108726 GCTCCCATCTCAGGGCCACTCGG - Intronic
900733058 1:4275658-4275680 GCTTCTGTCTCAGGGTCACATGG - Intergenic
901867632 1:12117521-12117543 GCCTCCATTTCAGGGTGATGGGG - Intronic
902928789 1:19715930-19715952 GGCTCCATCTCAGGGACTCCAGG - Intronic
912391205 1:109304448-109304470 TCCTCCACCTCAGGGTCCCAGGG + Intronic
918072564 1:181143669-181143691 TCCTCCATCTGATGGTCACTGGG + Intergenic
920397862 1:205659756-205659778 GCCTCCATCCCAGGGGCAATGGG + Intronic
921146351 1:212361563-212361585 GCCTCCATCCCTGGGTCAGGAGG - Exonic
923770107 1:236930893-236930915 GCCACCATCTCAAAGTCACTGGG - Intergenic
1068402129 10:56542155-56542177 GCCTCTATCTTTGGATCACGTGG - Intergenic
1068862510 10:61861670-61861692 GCCTCAATCTGAGGCTCAGGTGG - Intergenic
1069635257 10:69921134-69921156 GGCTCCATCTGAGGGCCAAGGGG + Intronic
1070569063 10:77627309-77627331 GCCCCCTTCTCAGTTTCACGTGG - Intronic
1070765025 10:79051431-79051453 TCCTGCAACACAGGGTCACGTGG + Intergenic
1073434189 10:103506293-103506315 CCCTCCCTCTCAGGGGCACCTGG - Intronic
1073625752 10:105095191-105095213 GCCTCCATCTCTGGAGCACAAGG + Intronic
1074185036 10:111093733-111093755 GCCTCAAAGTCAGGGTCACTTGG + Intergenic
1074402615 10:113154220-113154242 ATCTCCACCTCAGGGTCAGGTGG - Intronic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075598279 10:123748113-123748135 GCCTGCATCACAGAGTCACTTGG - Intronic
1076531639 10:131149064-131149086 GCGACCTTCTCAGGGTCACCTGG - Intronic
1077405724 11:2381719-2381741 GCCTGGATCACAGGGACACGGGG - Intronic
1083212731 11:61198763-61198785 GCCTCCATCCCAGGGGCACTTGG - Intergenic
1084774729 11:71367946-71367968 GCCCCCATCACAGGGTCATGTGG - Intergenic
1084972348 11:72778772-72778794 GCCTGCATCCCAGGGGCAGGAGG + Intronic
1092737731 12:11599122-11599144 GTGTCCAACTCAGGGTCAAGTGG - Intergenic
1094166275 12:27446997-27447019 GTCTCCATGTCAGAATCACGTGG - Intergenic
1097064467 12:56310753-56310775 ACCTGTATCTCAGGGTCAAGGGG + Intronic
1098160753 12:67647299-67647321 GCCTCCAAGTTAGGGTCACTGGG - Intergenic
1104465091 12:128983790-128983812 GCCTCCATCTCAGGGTCACGCGG - Exonic
1104687442 12:130796899-130796921 GCCTCCCTCTGAGGGCCACATGG + Intronic
1112280564 13:98059426-98059448 GCCTGCCTCTGAGGGTCACTGGG - Intergenic
1115509271 14:34123897-34123919 GCCTCCATAACAGGGTCACTTGG - Intronic
1115861245 14:37688164-37688186 ACCGCCATCTCAGGCCCACGAGG - Intronic
1116942608 14:50805390-50805412 ACCTCCCTCTCAGGCTCACTGGG + Intronic
1120404239 14:84074024-84074046 GCCTGCATGTCAGCTTCACGAGG + Intergenic
1121368166 14:93333116-93333138 TCGTCCCGCTCAGGGTCACGTGG + Intergenic
1122909951 14:104822666-104822688 GCCTGCATCTCAGTGTTAAGGGG + Intergenic
1123663430 15:22586525-22586547 GCCTCCTTCTCAGGGGAAAGGGG - Intergenic
1124317260 15:28680957-28680979 GCCTCCTTCTCAGGGGAAAGGGG - Intergenic
1128544287 15:68556797-68556819 GGCTCCATGACAAGGTCACGTGG - Intergenic
1129693141 15:77724955-77724977 GCCTTCATCTCAGGCTCTCCTGG - Intronic
1129860062 15:78853838-78853860 GCCTCCACCTCTGGTTCAAGCGG + Intronic
1132519112 16:379287-379309 GCCTCTATGGGAGGGTCACGAGG - Intronic
1133832202 16:9333494-9333516 GCCTCCCTCACAGAGTCATGGGG + Intergenic
1134894159 16:17869725-17869747 GCCTCCATCCCAGGCTAATGGGG + Intergenic
1139475253 16:67199669-67199691 GGCTCCACCTGAGGGGCACGAGG - Exonic
1141211733 16:81987275-81987297 GCCACCTTCTCAGAATCACGCGG + Intergenic
1141955707 16:87370161-87370183 CCCTCCCTCTCAGGGGCCCGGGG + Intronic
1147874943 17:43614415-43614437 GCCTCCATCCCAGGCTCTCCAGG + Intergenic
1149442955 17:56690606-56690628 GCCTCCATTTCAGGGCCAGTGGG + Intergenic
1152123454 17:78432801-78432823 GCCTCCACCTCAGGGCCTGGGGG - Intronic
1152534216 17:80941107-80941129 GCCACCATTTCAGGGACAAGTGG - Intronic
1154111887 18:11577326-11577348 GCCCCCATCTCAGGCTCACAAGG + Intergenic
1154405881 18:14090644-14090666 GACTCCATCTGAGGGTCCAGGGG + Intronic
1157401301 18:47390759-47390781 GCCTGCATCTTAGGGTCCCCAGG - Intergenic
1159946452 18:74447648-74447670 GCCTACACTTCAGGGTCACTGGG + Intronic
1160411730 18:78679658-78679680 GCCTCCATCTGAAGGTCCCTGGG + Intergenic
1161043825 19:2123930-2123952 GACACCAACTCAGGGCCACGGGG + Intronic
1162453090 19:10766418-10766440 GCCACCTTCTCAGGGTCAGGGGG - Intronic
1163129439 19:15263439-15263461 GCCACCACCTCATGGTCAGGAGG + Exonic
1164728075 19:30480225-30480247 TCATCCATCTCAGGCTCCCGTGG + Intronic
1165891212 19:39113420-39113442 GGCTCCGTCTCAGGTCCACGAGG + Intergenic
1166727480 19:45037672-45037694 GCCTCCATCCCCGGGGCCCGGGG - Exonic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925598446 2:5583421-5583443 CCCTCCATCTCGGGTTCATGAGG + Intergenic
926268512 2:11346386-11346408 GCCTCCAACTCAGCCTCAGGGGG - Intronic
930395652 2:50820641-50820663 GTCTACATCCCAGGGTCACCTGG - Intronic
931254146 2:60555415-60555437 ACCTGCAGCTCAGGGTCTCGCGG - Intergenic
938926673 2:136049363-136049385 GCAGCCATCTCACAGTCACGGGG + Intergenic
938949347 2:136242755-136242777 ACCTCCATCTCTGGGTGACCTGG + Intergenic
945159584 2:206875660-206875682 GCCTCCCTCACAGGGTCATTTGG - Intergenic
947229445 2:227870512-227870534 GCGTCCATCTCAGGGAGACCTGG - Intergenic
947767842 2:232648894-232648916 GCCTGCATCTCAGGGACACCAGG - Intronic
948760756 2:240189699-240189721 TCCTCCATCTCAGGGTATGGTGG + Intergenic
948767131 2:240228272-240228294 GCCTCCAGCCCAGGGCCAGGAGG + Intergenic
1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG + Intergenic
1171384992 20:24764015-24764037 GCCTCCACCTCAGGGTCATCTGG - Intergenic
1172185619 20:33029365-33029387 TTCTTCAGCTCAGGGTCACGAGG + Intergenic
1172846690 20:37933948-37933970 TACGCCATCTCAGGGTCACTTGG + Intronic
1173166832 20:40691625-40691647 GCCTCCGACTCAGGGTCTCTTGG + Intergenic
1174035827 20:47667770-47667792 GTCACCATCTCGGGGTCACTTGG - Intronic
1174167819 20:48597856-48597878 TCCTTCATTTCAGGGTCACCTGG - Intergenic
1174799821 20:53553907-53553929 GACTCCATCTCGGGGTGATGGGG + Intergenic
1175948435 20:62569644-62569666 GCCTCCATCCCATGCTCAGGAGG - Intronic
1175963769 20:62649912-62649934 GCCTCCCTCCAAGGGCCACGGGG - Intronic
1176060941 20:63172749-63172771 GCCTGCAGCTCATGGTCCCGGGG - Intergenic
1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG + Intronic
1176380116 21:6108137-6108159 GCATCCTTCTCAGGGACCCGGGG - Intergenic
1179743358 21:43430101-43430123 GCATCCTTCTCAGGGACCCGGGG + Intergenic
1179819587 21:43929112-43929134 GCCTCCTTCTGAAGGTCACAGGG - Intronic
1184240129 22:43207486-43207508 GGCCCCATCCCAGGGTTACGTGG + Intronic
1185163796 22:49245271-49245293 GCCCCCATCTCAGGGGAACAAGG + Intergenic
1185362784 22:50419010-50419032 GCCTCCCTTTCTGGGTCATGGGG + Intronic
951001227 3:17562059-17562081 GCCTCCATCTCAAGGACTCAGGG - Intronic
952383385 3:32821383-32821405 GCCTCCTTCCCAAGGTCAGGTGG - Intronic
953668451 3:44943001-44943023 GCCTCCATCTCAGGCACAGGAGG + Intronic
953722103 3:45365335-45365357 GCATCCCTTTCAGGGTCACAAGG - Intergenic
953881987 3:46695412-46695434 GCCTCCTTCTCGGGGTTATGTGG + Intergenic
955365953 3:58310122-58310144 GCCTCCACCTCTGGCTCTCGAGG - Intronic
961463565 3:127068247-127068269 GGCTGGATCTCAGGGTCACTGGG - Intergenic
967483921 3:190008143-190008165 GTGTTCTTCTCAGGGTCACGTGG + Intronic
969495563 4:7524269-7524291 GCCTCAATCTCAGGGACGCCTGG + Intronic
969974513 4:11084547-11084569 GCCTCTAGCTCAAGGTCACATGG + Intergenic
971954335 4:33396321-33396343 ACCACCATCTCAGGGCCATGAGG - Intergenic
972374387 4:38456942-38456964 GCCTCCATGTGAGGGTCAGCAGG - Intergenic
973839091 4:54842752-54842774 GCCTCCTCCACAGTGTCACGTGG + Intergenic
978465685 4:109006294-109006316 ACCTCCATCTCAGGTTCAAGCGG + Intronic
984933530 4:184869505-184869527 GCCTCCAGCTCATGGTAAAGAGG + Intergenic
985100114 4:186450500-186450522 GCCTCCCTCTCAGCCTCACTTGG + Intronic
985896977 5:2754676-2754698 GACTCCGTCTCGGGGCCACGAGG + Intronic
987425016 5:17763100-17763122 GCCTCCATGTCAGGCTGACCTGG - Intergenic
994007000 5:94849519-94849541 GCCTCCATCTCTGTCTCACAGGG + Intronic
995738186 5:115325853-115325875 GCCTCCAGCTGTGGGTCATGGGG - Intergenic
996354069 5:122577420-122577442 CCTTGCATCTCAGGGTCAGGAGG + Intergenic
999380334 5:151117072-151117094 ACCTACATCTCAGGGACACCCGG + Intronic
1002108699 5:176893513-176893535 GGCTACATCTGAGGGCCACGAGG + Intronic
1002310157 5:178309307-178309329 GCCTGCCTCCCAGGGTCACTGGG + Intronic
1004997145 6:21204613-21204635 GCCTTCCTCTCAGGGTTATGAGG - Intronic
1005980359 6:30831617-30831639 GCCCCCAACTCAGGGGCACCAGG - Intergenic
1006029041 6:31165751-31165773 GCTTGGATCTCAGGGTCACAAGG - Intronic
1006146261 6:31961585-31961607 GCCTCCATCTCAGGAGCAGTGGG + Exonic
1010932097 6:81815754-81815776 TCCTCCATCTCTGGGCCAGGTGG - Intergenic
1015548431 6:134386409-134386431 GCTTCCATCAAAGGGTCACAAGG - Intergenic
1021507864 7:21405205-21405227 GCCTTCATCTCAGGGTCTGGAGG + Intergenic
1029106528 7:98181356-98181378 GCCTCCATCTCAAGGACTCAAGG + Intronic
1030078506 7:105757660-105757682 GCCTCCATCTCCGGGGCCCAAGG + Intronic
1030426759 7:109387826-109387848 GCCTACAGCTCAGGGCCACTGGG + Intergenic
1034147171 7:148883929-148883951 GCCTCACTCGCAGGGTCCCGCGG + Intronic
1035583284 8:753547-753569 GCCTCCCTCTCAGCGCCTCGCGG - Intergenic
1036950024 8:13132114-13132136 GCCTCCTTGTCCGGGTCAAGGGG + Intronic
1037889503 8:22616111-22616133 TCCTCCTTCTCAGGTTCAGGTGG - Exonic
1039248254 8:35633053-35633075 TCCTCCATGTCAGGTTCATGGGG + Intronic
1041064878 8:54073116-54073138 GCGTCCATCTCAGGGAGACCTGG + Intronic
1041215488 8:55596162-55596184 GGCTCCATCTAAAGGTCACTGGG + Intergenic
1042294754 8:67206730-67206752 GCCTCCATCTCAGATTCTCAGGG + Intronic
1043941692 8:86203474-86203496 ACTTTCACCTCAGGGTCACGAGG + Intergenic
1045482307 8:102601907-102601929 CCCTCCACCTCAGAGTCCCGGGG - Intergenic
1048305543 8:133281547-133281569 GACTCCATCTCTGGGTCAGTAGG - Intronic
1056580517 9:87885922-87885944 GCCTCAACCTCAGGTTCACCTGG - Exonic
1057259394 9:93575823-93575845 GCCTCCCTCGCAGGATCCCGCGG - Intergenic
1059433252 9:114262250-114262272 GCCTCAGTCTCAGGCTCACGTGG - Intronic
1060537082 9:124399256-124399278 GCCTCACTCTCAGGGTCTCACGG - Intronic
1062431232 9:136527708-136527730 GCGTCCCTCTTAGGGTCACCCGG + Intronic
1187930074 X:24285854-24285876 GACTCCATTTCAGGGTGACAGGG - Intergenic
1188672008 X:32891971-32891993 GCCTTCATTTCTGTGTCACGTGG - Intronic
1192149291 X:68701965-68701987 GCTTCCATCTCAGGGTCTTGGGG + Intronic
1193005495 X:76614196-76614218 GGCTCCATCTCAGGGATATGAGG + Intergenic
1196758674 X:119180097-119180119 GCCTCTATCTCAGAATCACCTGG - Intergenic