ID: 1104467108

View in Genome Browser
Species Human (GRCh38)
Location 12:128999557-128999579
Sequence CCAGTGGGGCCCCTGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104467094_1104467108 14 Left 1104467094 12:128999520-128999542 CCTTGTGTGGAGGGGTGCAGCCT No data
Right 1104467108 12:128999557-128999579 CCAGTGGGGCCCCTGCAGGGAGG No data
1104467096_1104467108 -6 Left 1104467096 12:128999540-128999562 CCTCTCCGGTCCCAGCCCCAGTG No data
Right 1104467108 12:128999557-128999579 CCAGTGGGGCCCCTGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104467108 Original CRISPR CCAGTGGGGCCCCTGCAGGG AGG Intergenic
No off target data available for this crispr