ID: 1104471986

View in Genome Browser
Species Human (GRCh38)
Location 12:129036711-129036733
Sequence GGCCAGTCTGGTCTCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104471986_1104471996 30 Left 1104471986 12:129036711-129036733 CCAACATGGAGACCAGACTGGCC No data
Right 1104471996 12:129036764-129036786 ATACAAAAATTAGCTGGGCATGG 0: 22048
1: 51794
2: 93615
3: 107662
4: 119956
1104471986_1104471994 24 Left 1104471986 12:129036711-129036733 CCAACATGGAGACCAGACTGGCC No data
Right 1104471994 12:129036758-129036780 CTAAAAATACAAAAATTAGCTGG 0: 84164
1: 74614
2: 45566
3: 28364
4: 50515
1104471986_1104471995 25 Left 1104471986 12:129036711-129036733 CCAACATGGAGACCAGACTGGCC No data
Right 1104471995 12:129036759-129036781 TAAAAATACAAAAATTAGCTGGG 0: 58150
1: 129705
2: 102168
3: 63447
4: 65966

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104471986 Original CRISPR GGCCAGTCTGGTCTCCATGT TGG (reversed) Intergenic
No off target data available for this crispr