ID: 1104476248

View in Genome Browser
Species Human (GRCh38)
Location 12:129072878-129072900
Sequence CCAGCCTCTTCAAAGACGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104476244_1104476248 -10 Left 1104476244 12:129072865-129072887 CCATGCCTAGAGACCAGCCTCTT 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476243_1104476248 -9 Left 1104476243 12:129072864-129072886 CCCATGCCTAGAGACCAGCCTCT 0: 1
1: 0
2: 3
3: 11
4: 168
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476240_1104476248 19 Left 1104476240 12:129072836-129072858 CCTGGTATGGAATTCACCGTGAC 0: 1
1: 0
2: 0
3: 5
4: 26
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476241_1104476248 3 Left 1104476241 12:129072852-129072874 CCGTGACTACCGCCCATGCCTAG 0: 1
1: 0
2: 2
3: 3
4: 50
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476238_1104476248 21 Left 1104476238 12:129072834-129072856 CCCCTGGTATGGAATTCACCGTG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476239_1104476248 20 Left 1104476239 12:129072835-129072857 CCCTGGTATGGAATTCACCGTGA 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1104476242_1104476248 -6 Left 1104476242 12:129072861-129072883 CCGCCCATGCCTAGAGACCAGCC 0: 1
1: 0
2: 0
3: 14
4: 227
Right 1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104476248 Original CRISPR CCAGCCTCTTCAAAGACGGA CGG Exonic
903130733 1:21278005-21278027 CCAGCAACTTCACAGAGGGAAGG + Intronic
903974337 1:27139245-27139267 CCAGACCCTTCTAAGAGGGAGGG - Intronic
905632054 1:39524452-39524474 CCAGCCTCTCCACACAAGGAGGG + Intronic
909678441 1:78263974-78263996 ACAGCAACTTCAAAGACTGAAGG + Intergenic
911311493 1:96297574-96297596 ACAGCAGCTTCAAAGACTGAAGG - Intergenic
912594579 1:110861260-110861282 ACAGCAACTTCAAAGACTGAAGG + Intergenic
912594867 1:110864586-110864608 ACAGCATCTTCAAAGACTGAGGG + Intergenic
914682845 1:149951534-149951556 TCAGCGTGTTCAAATACGGAGGG + Intronic
917182157 1:172310577-172310599 GCAGGCTCTTCAAAGAAGGGAGG + Intronic
917895819 1:179485548-179485570 ACAGCAACTTCAAAGACTGAAGG + Intronic
918103674 1:181398211-181398233 CAAGACTCTTCAGAGAAGGAAGG - Intergenic
918958016 1:191236133-191236155 CAAGCCTCTTCGAAGATGTAGGG - Intergenic
923186346 1:231577199-231577221 CCACCCTCTGCAAATACGTAAGG - Intronic
1065037636 10:21656084-21656106 CCAACCTCTTCAAACACTCAAGG - Intronic
1068833037 10:61520096-61520118 ACAGCATCTTCAAAGATTGAAGG - Intergenic
1069874925 10:71555945-71555967 ACAGCCTCTTCTAAGAAGGGAGG + Intronic
1071451320 10:85793577-85793599 CCAGCCTCTTCAGGGTCTGATGG + Intronic
1072374408 10:94800147-94800169 CCAGCAACATCAAAGACGAAAGG - Intronic
1075677377 10:124304661-124304683 CCATCCTCTTCAAAGAAGGGGGG + Intergenic
1079732205 11:23948190-23948212 CAAGCCTCTGCAAAGAGGCATGG - Intergenic
1083919312 11:65773075-65773097 ACAGGCACTTCAAAGAAGGAGGG + Intergenic
1085812849 11:79700985-79701007 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1086455804 11:86957289-86957311 AGAGGCTCTTCAAAGATGGAAGG + Intergenic
1086760187 11:90620235-90620257 GCAGCCACTTTAAAGACTGAAGG + Intergenic
1087259059 11:95990412-95990434 CCAGCATATTCAAAGACCTAGGG - Intronic
1089384942 11:118061207-118061229 CCCGCCTCTTCCAAGAAGGGAGG + Intergenic
1094111611 12:26868573-26868595 ACAGGCGCTTCAAAGAAGGAGGG + Intergenic
1094559070 12:31532765-31532787 CCAACTTGTTCAAAAACGGAAGG + Intronic
1094620176 12:32073297-32073319 CTAGCCTCCTCAAAGAGTGAGGG + Intergenic
1096598727 12:52714563-52714585 CCAGTCTCTGCAAAGACGGTCGG + Intergenic
1102803579 12:115759277-115759299 CTAGCATCTTCGAAGACAGAAGG - Intergenic
1104156217 12:126135748-126135770 ACAGCAACTTCAAAGACTGAAGG - Intergenic
1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG + Exonic
1105424374 13:20282497-20282519 CCTGCCTCTTCCAAGATGGCGGG + Intergenic
1106416622 13:29551262-29551284 TCAGCCTCTGCAAAGAGGGAGGG - Intronic
1106983158 13:35314144-35314166 CCTGCCACTTCATAGACAGAAGG - Intronic
1108799277 13:54073274-54073296 ACAGCAACTTCAAAGACAGATGG + Intergenic
1109474301 13:62858157-62858179 ACACACTCTTCAAAGAGGGAAGG - Intergenic
1109666942 13:65552576-65552598 CCAGCAACTTCAAAGATTGAAGG - Intergenic
1113224945 13:108149013-108149035 CCAGCCTCATTAAAGGCGTAAGG - Intergenic
1114861395 14:26527744-26527766 CCATACTATTCAAAGACAGACGG + Intronic
1115602377 14:34967758-34967780 CCAGCCTGAACAAAGACAGAAGG + Intergenic
1116282566 14:42928019-42928041 ACAGCAGCTTCAAAGACTGAAGG - Intergenic
1116782536 14:49251619-49251641 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1117390695 14:55259706-55259728 ACAGGCTCTTGAAAGAAGGATGG + Intergenic
1118487085 14:66224520-66224542 TCTGCCTCTTCAAAGACAGAGGG - Intergenic
1120733254 14:88025803-88025825 CCAGCATCTTCAGGGAGGGATGG - Intergenic
1123885048 15:24718399-24718421 CCAGACTCTTCAGAGACAGCAGG + Intergenic
1125728139 15:41878580-41878602 CCAGCCTCTGCAAGGACAGGTGG - Exonic
1125778575 15:42242399-42242421 CCAGCCTTTTCAAAGAAAGAAGG + Intronic
1126575315 15:50190976-50190998 CCAGCCTCTTCCAAGAAATAAGG + Intronic
1128968484 15:72085760-72085782 ACAGCATCTTCAAAGATTGAAGG - Intronic
1129864031 15:78888710-78888732 CCAGCCTCTTAAAAAAAGTAAGG + Intronic
1129931313 15:79413075-79413097 ACAGCAACTTCAAAGACTGAAGG + Intronic
1129974419 15:79810219-79810241 CCAGCCTTTTGAGAGAAGGAAGG + Intergenic
1135500306 16:22990348-22990370 ACAGCTTCTTCAAAGACTGCTGG + Intergenic
1137504079 16:49035815-49035837 CCAGCCTCAGCAAAGAGTGAGGG - Intergenic
1138776590 16:59730323-59730345 ACAGCAACTTCAAAGACTGAAGG + Intronic
1139007156 16:62586945-62586967 CCAGCCTGTTCAAATTCAGAGGG - Intergenic
1139265210 16:65631967-65631989 GCAGCCTCTTCAAGGAGGGTAGG - Intergenic
1141347290 16:83258913-83258935 TCACCCTCTTCAAAGGTGGAAGG - Intronic
1141476056 16:84274273-84274295 CCAGCCTCTGGAAATAAGGATGG + Intergenic
1146232896 17:31130053-31130075 ACAGCGACTTCAAAGACTGAAGG - Intronic
1146716860 17:35093578-35093600 CCAGACTCCTCCAAGACTGAAGG + Intronic
1148581991 17:48750526-48750548 CCAGCAGCTTCCAAGATGGAAGG + Intergenic
1149448467 17:56731984-56732006 CCAGCCACTTCCAAGACTGCTGG + Intergenic
1149830868 17:59870651-59870673 CCAGCCTTTTCAGAGCTGGACGG - Intronic
1151881634 17:76899048-76899070 CCTGGCTCTTGCAAGACGGATGG + Intronic
1153861779 18:9218270-9218292 CCAGTCTCTTCCCAGAGGGAGGG + Intronic
1157480631 18:48051390-48051412 GCAGCCTCTACATAGACGAAGGG - Intronic
1157755081 18:50210529-50210551 CCAGCCTCTTGAAACACGCAGGG + Intergenic
1159292328 18:66439469-66439491 CCACCCTCTTCCAAGTTGGAAGG + Intergenic
1159428146 18:68315625-68315647 AATGCCTCTTCAAAGATGGATGG + Intergenic
1160355908 18:78228329-78228351 CCATTCTGTTCAAAGACAGAGGG - Intergenic
1161243172 19:3234267-3234289 CCAATCTCTTGAAAGAGGGAGGG - Intronic
1165180360 19:33962296-33962318 CCAGCCTGGGCAAAGAAGGAAGG + Intergenic
1168708125 19:58481094-58481116 CCAGCCTCTGCACAGACGAGTGG - Exonic
925150753 2:1613065-1613087 CCAGCCTCTTTAAACATGGGAGG - Intergenic
925412553 2:3648307-3648329 AAAGCCTCATCAAAGACAGATGG - Intergenic
927024081 2:19047803-19047825 GCAGCCACTTAAAAGAAGGAAGG + Intergenic
928601522 2:32908550-32908572 CCAGACTCTGGAAAGACCGATGG - Intergenic
929382149 2:41365691-41365713 CCAGCAACTTCAAAGACTGAAGG + Intergenic
933706734 2:85296724-85296746 CCAGTCTATACAAAGACGAATGG - Intronic
933717095 2:85369582-85369604 CCAGCCTCTTGAAAGAAGATTGG + Intronic
935145656 2:100393423-100393445 CCAGCCTCTTTTAAGATGTATGG + Exonic
935270456 2:101429928-101429950 CCAGCCTCTTGAAAGCCCCAGGG + Intronic
935374134 2:102378136-102378158 ACAGCTTCATCAAAGAAGGAAGG - Intronic
936626422 2:114153983-114154005 TCAGCCTCTCCAAAGACTCAAGG - Intergenic
938585968 2:132690944-132690966 CCACCCTCTTTAAGGATGGAGGG - Intronic
940904141 2:159153644-159153666 CCTGCCTCTTCAAAGACCTGTGG - Intronic
942293310 2:174493782-174493804 CCTGCCCCTTCAAGGAAGGAAGG - Intergenic
942429853 2:175898975-175898997 CCATACTCTGCAAAGACTGATGG - Intergenic
943073662 2:183171064-183171086 ACAGCAACTTCAAAGACTGAAGG - Intergenic
943501264 2:188692797-188692819 ACAGCAACTTCAAAGACTGAAGG - Intergenic
944035618 2:195291020-195291042 TCAGCAGCTTCAAAGACTGAAGG + Intergenic
945370253 2:209007253-209007275 CCAGCCTCTTGAAAGACAGCTGG + Intergenic
945840600 2:214883446-214883468 CCATCATCATCAAAGACGAAGGG + Intergenic
947983590 2:234429868-234429890 CTAGCCCCTTCATTGACGGAGGG - Intergenic
948918305 2:241049579-241049601 CCTGCCTCGTAGAAGACGGAAGG + Intronic
949063274 2:241973950-241973972 CCAGCCCCATCACAGACGGCAGG + Intergenic
1169923679 20:10760627-10760649 CCAGACTCTTCAAACACTGTTGG - Intergenic
1170026648 20:11895805-11895827 CCAGTCTGCTCAAAGACTGAGGG - Intronic
1170520619 20:17180723-17180745 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1170535474 20:17336783-17336805 CGACCCTCTTCAGACACGGATGG - Intronic
1171321262 20:24246574-24246596 GCAGGCACTTCGAAGACGGATGG - Intergenic
1173672218 20:44806473-44806495 TAAGCCACTTCAAAGAAGGAGGG + Intronic
1174185374 20:48702589-48702611 CCAGCCTCTGGAAAGAGGAAAGG - Intronic
1178108772 21:29349987-29350009 CCAGCCTCTCCAAAGGCCTAAGG + Intronic
1179941531 21:44641784-44641806 CCAGCCTCTACCAAGGTGGAGGG + Intronic
1181658563 22:24322076-24322098 CCATCCTCCTCAGAGTCGGAAGG + Exonic
1182775707 22:32829621-32829643 CCAGCCTCTTCACAGACTGCTGG + Intronic
1183299818 22:37053320-37053342 CCTGCCTCTTCCCAGTCGGACGG + Intronic
1183404086 22:37621600-37621622 CCAGCATCTGCAGAGACAGAGGG - Exonic
1184818678 22:46892373-46892395 ACAGCAGCTTCAAAGACGGATGG + Intronic
949922249 3:9012190-9012212 GCAGCTGCTTCAAAGAAGGAAGG - Intronic
952883807 3:38001017-38001039 AAAGCCTGTTCAAAGACTGAAGG - Intronic
953712562 3:45287068-45287090 AGAGCCTCTTCAAACAGGGAAGG + Intergenic
954362723 3:50130730-50130752 CCAGCCTCTTGAGAGAAGGCAGG + Intergenic
956904557 3:73752445-73752467 ACAGCATCTTCAAAGTCAGATGG - Intergenic
961528475 3:127524557-127524579 CCAGCCTCTGCAGAGTGGGAGGG - Intergenic
962655596 3:137541666-137541688 ACAGCAACTTCAAAGACTGAAGG - Intergenic
963453750 3:145517462-145517484 CCAGACTCTTCAAGGAATGAAGG - Intergenic
970980760 4:22094384-22094406 CCAGTATGTTCAAAGACAGATGG - Intergenic
973673763 4:53242486-53242508 ACAGCAACTTCAAAGACTGAAGG + Intronic
976698844 4:87947299-87947321 CCACTCTCCTCGAAGACGGAGGG - Intergenic
977482346 4:97594008-97594030 CCAGCAACTTCAAAGACTGAAGG + Intronic
984057482 4:174948297-174948319 CCAGCAACTTCAAAGATGGGAGG - Intronic
988324058 5:29738494-29738516 ACAGCAACTTCAAAGACTGAAGG + Intergenic
988675308 5:33427476-33427498 ACAGCAACTTCAAAGACTGAAGG - Intergenic
989086674 5:37684433-37684455 ACAGCAACTTCAAAGACTGAAGG - Intronic
989523956 5:42431351-42431373 CCAGGTTCTTCAAAGAAGGATGG + Intronic
991174280 5:63668334-63668356 ACAGCAGCTTCAAAGACTGAAGG + Intergenic
994897176 5:105721389-105721411 TCAGACTCTTCAAAGCCTGAAGG - Intergenic
995010603 5:107253575-107253597 TCAGCATCTTCAAAGTCGAACGG - Intergenic
995995298 5:118291387-118291409 ACAGCAACTTCAAAGACTGAAGG - Intergenic
996004559 5:118405069-118405091 CCAGCCTCTTCAGAGCCAGCAGG + Intergenic
996166992 5:120236425-120236447 TCAGCACCTTCAAAGACTGAAGG - Intergenic
998487377 5:142514851-142514873 CCAGTCTTTTCAAAGAAAGATGG - Intergenic
1000367741 5:160506633-160506655 CCAGCTTCTTCATAGAATGAGGG - Intergenic
1001774695 5:174320432-174320454 CCAGCCTCTTCCAACAGGCAGGG - Intergenic
1001851339 5:174969596-174969618 ACAGCAACTTCAAAGACTGAAGG - Intergenic
1007314730 6:40978378-40978400 TCAGCAACTTCAAAGACTGAAGG - Intergenic
1008545911 6:52583144-52583166 CCAGGCTCTTCAAAGGAGGCTGG - Intergenic
1010317237 6:74465918-74465940 ACAGCAACTTCAAAGACTGAAGG - Intergenic
1015282658 6:131450340-131450362 TCAGCCTTTTCAAAGACTCAAGG - Intergenic
1020665826 7:11041693-11041715 CCAGCTTTTTCAAACACGGTTGG + Intronic
1021967304 7:25933089-25933111 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1024544038 7:50502238-50502260 CCAGCCTCTACAAAGAAGAGGGG + Intronic
1024638660 7:51311328-51311350 CCAGCCCCTCCAGAGAAGGATGG - Intronic
1025957834 7:66196367-66196389 CCAGCCTCTTTAACCAGGGAGGG + Intergenic
1028285056 7:88986257-88986279 CCAACCTCTTCAAAGCAAGATGG + Intronic
1028353321 7:89877019-89877041 CCAGCAACTTCAAAGACTAAAGG - Intergenic
1031669422 7:124524805-124524827 ACAGCAACTTCAAAGACTGAAGG - Intergenic
1033368930 7:140691776-140691798 CCTGCCTCTTGGAAGACTGAGGG - Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035879619 8:3230911-3230933 CCAGACTCTGCAAAGCCGGCTGG + Intronic
1037404444 8:18526476-18526498 CCTCTCTCTTCAAAGAGGGAAGG - Intergenic
1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG + Intergenic
1041429189 8:57759585-57759607 ACAGCAGCTTCAAAGACTGAGGG + Intergenic
1041982284 8:63876209-63876231 CCAGCCTCATCAGTGACTGATGG + Intergenic
1041982613 8:63880596-63880618 GCACCCTCTTCAAATACTGATGG + Intergenic
1046634476 8:116658537-116658559 CCAGCCCCTTCAATGAGGGAGGG + Intronic
1047481163 8:125284364-125284386 CCATCCACTTCAGAGAAGGAGGG + Intronic
1048062520 8:130935196-130935218 CAAGCCTCTTCGAAGACAGCTGG - Intronic
1051794400 9:20848523-20848545 CTAGCCTCTTGGAAGATGGAAGG + Intronic
1054716353 9:68560779-68560801 CCAGCCTCTCCAAAGTGGAAGGG - Intergenic
1059428073 9:114233481-114233503 AAAGCCCCTTCAAAGAGGGAGGG - Intronic
1186702402 X:12106065-12106087 CCAGGCTCTTCAAAGCAGAAAGG + Intergenic
1189897893 X:45674207-45674229 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1191782096 X:64879678-64879700 TCAGCATCATCAAAGACTGAAGG + Intergenic
1191919911 X:66244789-66244811 ACAGCAACTTCAAAGACTGAAGG - Intronic
1193392709 X:80948412-80948434 ACAGCAACTTCAAAGACTGAAGG - Intergenic
1193823663 X:86195941-86195963 GCAGCAACTTCAAAGACTGAAGG + Intronic
1194583055 X:95699831-95699853 TCCTCCTCTTCAAAGATGGATGG - Intergenic
1197141601 X:123122809-123122831 ACAGCAACTTCAAAGACTGAAGG + Intergenic
1198620092 X:138498486-138498508 CCTGCCTCTTCACAGACAGTCGG + Intergenic
1198767263 X:140092026-140092048 CCAGCCTCTACAAAGAGAGCGGG + Intergenic