ID: 1104478186

View in Genome Browser
Species Human (GRCh38)
Location 12:129087679-129087701
Sequence ACACCTTGATGTCGGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104478179_1104478186 12 Left 1104478179 12:129087644-129087666 CCACTAGAGCCTCTGGAGGGAGG 0: 4
1: 30
2: 121
3: 292
4: 725
Right 1104478186 12:129087679-129087701 ACACCTTGATGTCGGCCCAGTGG 0: 1
1: 0
2: 6
3: 34
4: 115
1104478177_1104478186 14 Left 1104478177 12:129087642-129087664 CCCCACTAGAGCCTCTGGAGGGA 0: 2
1: 2
2: 15
3: 58
4: 261
Right 1104478186 12:129087679-129087701 ACACCTTGATGTCGGCCCAGTGG 0: 1
1: 0
2: 6
3: 34
4: 115
1104478178_1104478186 13 Left 1104478178 12:129087643-129087665 CCCACTAGAGCCTCTGGAGGGAG 0: 2
1: 1
2: 17
3: 45
4: 241
Right 1104478186 12:129087679-129087701 ACACCTTGATGTCGGCCCAGTGG 0: 1
1: 0
2: 6
3: 34
4: 115
1104478182_1104478186 3 Left 1104478182 12:129087653-129087675 CCTCTGGAGGGAGGACAGGCCTA 0: 1
1: 0
2: 7
3: 36
4: 275
Right 1104478186 12:129087679-129087701 ACACCTTGATGTCGGCCCAGTGG 0: 1
1: 0
2: 6
3: 34
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104478186 Original CRISPR ACACCTTGATGTCGGCCCAG TGG Intronic