ID: 1104485537

View in Genome Browser
Species Human (GRCh38)
Location 12:129148749-129148771
Sequence TGGCATGCAGCTGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 413}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104485537_1104485549 15 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485549 12:129148787-129148809 CAGAGGCTTCCTGGCAGGCCAGG 0: 1
1: 0
2: 1
3: 62
4: 457
1104485537_1104485547 6 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485547 12:129148778-129148800 GTAAGGTGACAGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 234
1104485537_1104485550 16 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485550 12:129148788-129148810 AGAGGCTTCCTGGCAGGCCAGGG 0: 1
1: 1
2: 9
3: 33
4: 369
1104485537_1104485546 -2 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485546 12:129148770-129148792 CAGGGCTGGTAAGGTGACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 285
1104485537_1104485551 17 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485551 12:129148789-129148811 GAGGCTTCCTGGCAGGCCAGGGG 0: 1
1: 0
2: 5
3: 42
4: 353
1104485537_1104485548 10 Left 1104485537 12:129148749-129148771 CCCTCCTCCACAGCTGCATGCCA 0: 1
1: 0
2: 2
3: 37
4: 413
Right 1104485548 12:129148782-129148804 GGTGACAGAGGCTTCCTGGCAGG 0: 1
1: 0
2: 2
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104485537 Original CRISPR TGGCATGCAGCTGTGGAGGA GGG (reversed) Intronic
900463676 1:2813412-2813434 GGGCCAGCAGCTGCGGAGGAGGG + Intergenic
900887527 1:5425782-5425804 TGGGGTGCACCTGTGGAGAAGGG - Intergenic
901653427 1:10755862-10755884 TGGCCTGCAGCTGGGGTGGGGGG - Intronic
901949960 1:12736038-12736060 TGGCAATCATCTCTGGAGGAAGG + Intergenic
902541837 1:17161354-17161376 TGGAATGCAGATGTGATGGAGGG - Intergenic
904607727 1:31707144-31707166 AGGGTTGCAGCTGTGGAGGTGGG - Intergenic
905270660 1:36785479-36785501 TGGCATGCTGATGAGGAGGGAGG + Intergenic
905310004 1:37042628-37042650 AGGAATGCAGCTGTGGAGGCAGG + Intergenic
905473596 1:38210489-38210511 TGCCATGCAGGTGGGGAGGAAGG + Intergenic
906580470 1:46931185-46931207 TGGCAGGCAGAGGTGGAGGGAGG - Intronic
906603255 1:47147703-47147725 TGGCAGGCAGAGGTGGAGGGAGG + Intronic
906980144 1:50621115-50621137 TGGCATGTAGCTTAGGAGTATGG - Intronic
908889643 1:68830091-68830113 GGGCATGCAACAATGGAGGAAGG - Intergenic
912444201 1:109722157-109722179 TGGAATGCAGCTGTGATGGTTGG - Intronic
913041859 1:115034656-115034678 TGGCATGGAGGTGGGGAGTAAGG + Intergenic
913516528 1:119610068-119610090 TAGCATGGAGCTGGGGATGAGGG + Intergenic
914746926 1:150508038-150508060 TGGCAGGAAGCTGAGGAGGGCGG + Intergenic
915738017 1:158096797-158096819 GGACATGCAGCTGGGGAGGCGGG - Intronic
915831095 1:159130991-159131013 TGGCATTAAGCTGTGAAGGAAGG - Intronic
916339930 1:163721664-163721686 TGGAATGGAGCTGAGGAAGATGG - Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917580336 1:176370796-176370818 AGGCATGCACCTGTAGAGGTAGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918592107 1:186251603-186251625 TGCTATGCATCTGTGGAGGAAGG + Intergenic
918781560 1:188706211-188706233 TGGCTTGCAGTTCTGGAGGCTGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919814725 1:201430129-201430151 TGGCGTGGGTCTGTGGAGGAGGG - Intergenic
919830321 1:201536384-201536406 TGGCTCTAAGCTGTGGAGGAGGG + Intergenic
920509639 1:206541395-206541417 AGGGAGGCAGCTGGGGAGGAAGG + Intronic
921048469 1:211493725-211493747 TGGCAGGCAGGTGGGGAGCAGGG + Intergenic
921167178 1:212515361-212515383 TGGAGGGCTGCTGTGGAGGAAGG + Intergenic
922722891 1:227907718-227907740 TGGCATGCGGGTGTGGAGGCTGG - Intergenic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
924587498 1:245372777-245372799 TGGAATGCACCTGTGTAGGATGG + Intronic
1062949220 10:1484820-1484842 TGGCATGCAGGTGTGTATGTAGG + Intronic
1063446251 10:6119505-6119527 AGGAATGCAGGTGTGGAGTAGGG - Intergenic
1064528295 10:16281305-16281327 TAGCATGCAGTTTTAGAGGAAGG - Intergenic
1067009685 10:42698870-42698892 AGGCTTGCAGCTGTGGACAAAGG + Intergenic
1067166325 10:43869038-43869060 TGACATGGAGCTGTGGGGGGAGG + Intergenic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1069334102 10:67328120-67328142 TGGCATGTGTCTGTGGAGGTGGG - Intronic
1069606921 10:69744585-69744607 TGGCTTACAGTTGTGGAGGCTGG + Intergenic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1070675098 10:78406813-78406835 TGGCAGGCAGGTGAGGAAGACGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072894938 10:99358755-99358777 TGGCAGGCAGAGGTGGGGGAGGG - Intronic
1074085521 10:110206860-110206882 TGGAATTCAGCTGGGGAGGGGGG + Intergenic
1074531417 10:114301281-114301303 TGGCATCCAGGTGTTGAGGTTGG + Intronic
1075448005 10:122527034-122527056 TGGCAGGCCTGTGTGGAGGAGGG + Intergenic
1075950159 10:126470192-126470214 TTGCATGCTGCAGAGGAGGAGGG + Intronic
1076023566 10:127093858-127093880 TGGCTTGCAGTTCTGGAGGCTGG + Intronic
1076141705 10:128084556-128084578 AGGCATGCAGCTGGTGAGGATGG - Exonic
1076562528 10:131376636-131376658 TGGCCTGCAGTTCTTGAGGAAGG + Intergenic
1077606608 11:3616746-3616768 TGGCATCCAGGAGTGGAGGTGGG - Intergenic
1077954778 11:7004572-7004594 TGGCATGCAACTTTGGAGGCGGG + Intronic
1078018469 11:7635419-7635441 TGACATGAAGATGTGGAGGGAGG + Intronic
1078692410 11:13595343-13595365 TGGCCTGCAGCTTTGTAAGATGG - Intergenic
1078862074 11:15257854-15257876 TGTCATGCAGTTCTGGAGGCTGG - Intergenic
1078918786 11:15807248-15807270 TTGCCTGTGGCTGTGGAGGAGGG - Intergenic
1079238153 11:18704137-18704159 TGCCATGTAGATGTGGAGGAGGG + Exonic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079898101 11:26148307-26148329 TGGCCTGCACCTGTGAAGCAGGG + Intergenic
1081872183 11:46388245-46388267 CGGCAGCCGGCTGTGGAGGAAGG + Intergenic
1083433589 11:62627893-62627915 TGGCAGGCTGCTGTGCAGCATGG - Intronic
1083831441 11:65236373-65236395 TAGGGTGCAGCTGAGGAGGAGGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086063551 11:82724053-82724075 TGGTATCCAGCAGTGGAGGGAGG - Intergenic
1086353253 11:85965277-85965299 TGGCTTACAGTTGTGGAGGCTGG - Intronic
1086929530 11:92677580-92677602 TTTCTTGCAGCTTTGGAGGATGG + Intronic
1088745650 11:112801893-112801915 TGGCCTGCAGCAGAGGAGGCAGG + Intergenic
1089172152 11:116519851-116519873 TTGCATGAAGTTCTGGAGGAAGG - Intergenic
1089859064 11:121572688-121572710 TGCCAGGGAGCAGTGGAGGAGGG + Intronic
1090259576 11:125308979-125309001 TGGAGTGCATCTGTGGAGGAAGG - Intronic
1091686628 12:2567130-2567152 TGGAAAGCAGCTGTGGAGGATGG - Intronic
1091724826 12:2838626-2838648 TGGAATGTAGCTGTGGAGTAGGG + Intronic
1091788075 12:3255131-3255153 AGGCACGCAGCTGAGCAGGAGGG + Intronic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1093102742 12:15047603-15047625 TGGCATGCATCTGGGGTCGATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096908748 12:54961334-54961356 TGGCAGGTAGCTGTAGGGGAAGG + Intronic
1098343612 12:69476729-69476751 GGGCAGGCGGCTGTGGGGGAGGG + Intronic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1100955863 12:99907304-99907326 CGGCATGGGGCTGTGGAAGAGGG - Intronic
1101491132 12:105210724-105210746 GGGGATGCAGCTGTGAACGATGG - Intronic
1101961453 12:109253834-109253856 TGGCATGCAGATGGGGAAAAGGG - Intronic
1102151166 12:110689599-110689621 TGCCATGCAGGGGTGGAGGGTGG + Intronic
1102360587 12:112284357-112284379 TGGCCTGCAGCTGTGGGGTGTGG + Intronic
1102701286 12:114841764-114841786 TGGAATGAAGGTGGGGAGGAAGG - Intergenic
1104009235 12:124917432-124917454 TGGGCTGCAGCTGGGGAGGGCGG + Intergenic
1104324753 12:127785566-127785588 TGCCCTGCTTCTGTGGAGGAAGG - Intergenic
1104396035 12:128434052-128434074 TGGCATCCAGCTCTTGTGGATGG - Intronic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104746243 12:131212192-131212214 TGCCAGGAAGCTGAGGAGGAGGG - Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105230613 13:18491860-18491882 TGGAGTGCAGCTGTGGTGGTTGG - Intergenic
1105629120 13:22143669-22143691 TGGAATGTGGCTTTGGAGGAAGG + Intergenic
1105752553 13:23434761-23434783 TGGCATGCGCCTGTGGAGTGAGG + Intergenic
1106493947 13:30257456-30257478 TGGCATCCAGCTGGGAGGGATGG - Intronic
1108260649 13:48652212-48652234 CTTCATGCAGCTGTGGAGAAGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1111040399 13:82740418-82740440 TGGCAGGCAGCTCGGGAGTATGG - Intergenic
1112208233 13:97346968-97346990 TGGCCTGCAAGTGTGCAGGAGGG - Exonic
1113003655 13:105674335-105674357 TGGCAAGCAGATGTAAAGGATGG + Intergenic
1113085577 13:106567196-106567218 CGGCCTGCAGATGTGGAGGGTGG - Intronic
1113643487 13:111975785-111975807 GGGCATGCATGTGTGCAGGATGG + Intergenic
1113804768 13:113106516-113106538 GGGCATGGAGGTGTGGGGGATGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115344792 14:32330869-32330891 TGACATGCAGCTGTATAGGATGG + Intronic
1115435583 14:33369237-33369259 TGGCATCCAGCTGTCTAGGTCGG - Intronic
1115613213 14:35068771-35068793 TGGCTTACAGTTGTGGAGGCTGG + Intronic
1117053850 14:51890109-51890131 TTTCAGGCAGCTGTGGAGGATGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117962705 14:61178767-61178789 GGGCATGGGGCTGGGGAGGAAGG + Intergenic
1119623023 14:76147155-76147177 AAGCAGGCAGCAGTGGAGGAGGG - Intergenic
1119716626 14:76864194-76864216 TGTCCAGCAGCTGTGGAGGATGG + Intronic
1119907153 14:78316293-78316315 TGGCAGACAGCTGTGGGGGTAGG + Intronic
1120762525 14:88298466-88298488 AGGCGTGGAGCAGTGGAGGATGG - Intronic
1121104308 14:91270880-91270902 TGGATTCCAACTGTGGAGGAAGG + Intergenic
1121289688 14:92763813-92763835 AGGCATGCAGGTGTGCTGGAGGG + Intergenic
1122129816 14:99598531-99598553 TGGCATGGAGGAGTGGGGGAAGG - Intronic
1122624024 14:103075169-103075191 TGGCAACCAGCCGGGGAGGAAGG - Intergenic
1122644966 14:103188118-103188140 GGGCAGGCAGCTGTGGGGGCTGG + Intergenic
1124230178 15:27938241-27938263 GTGCATGTAGCTGTGCAGGAGGG + Intronic
1124953661 15:34345841-34345863 AGGCATTCTGCTGTGGGGGAGGG - Intronic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126865895 15:52936401-52936423 TGGAATGCTGGTATGGAGGAAGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128371788 15:67045036-67045058 TGGCATGCACCTGTAGTGGGAGG - Intergenic
1128460573 15:67863708-67863730 TGGAGTGCAGCGGTGGAAGAGGG - Intergenic
1129110552 15:73334654-73334676 GGGGAGGCAGGTGTGGAGGATGG - Intronic
1129736927 15:77971845-77971867 TGGCCTGAAGGTGGGGAGGAGGG + Intergenic
1129849142 15:78781776-78781798 TGGCCTGAAGATGGGGAGGAGGG - Intronic
1130130742 15:81140443-81140465 TGTCATGCACCTGTAGAGAAAGG - Intronic
1130827972 15:87568939-87568961 TGGAGTGCTGCTCTGGAGGATGG - Intergenic
1131377761 15:91939670-91939692 TGGAATGCTGCAGAGGAGGAGGG - Intronic
1131671734 15:94626978-94627000 TAGAAGGCAGCTGTGGAGGTTGG + Intergenic
1132228532 15:100164121-100164143 TGGAGTGCAGGGGTGGAGGAGGG - Intronic
1132461596 16:58008-58030 TGGCTGGAAGCTGTGGAGGGAGG - Intergenic
1133128530 16:3662388-3662410 TGGCATGGAGCAGAGGACGATGG - Exonic
1135591915 16:23711119-23711141 GGGGATGCAGCAGGGGAGGAAGG + Intronic
1136396476 16:29995280-29995302 GGGCTTGCTGCTGAGGAGGAGGG - Exonic
1138495297 16:57405218-57405240 GGGCATGCAGCTGATGAGGGAGG + Intronic
1139124640 16:64063406-64063428 TTGCATGCAGTTGTCCAGGAAGG - Intergenic
1139420545 16:66847011-66847033 GGGCCTGCAGGTGGGGAGGAGGG - Exonic
1139590219 16:67929130-67929152 CTGAAGGCAGCTGTGGAGGAAGG - Exonic
1139701684 16:68711615-68711637 TGGCCAGCAGCTGGAGAGGAAGG + Intronic
1141998724 16:87651325-87651347 CAGCATGCAGCTGTGGATCAAGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144335939 17:14268983-14269005 TGGGATGTAGATGTGGAGAAGGG - Intergenic
1144583172 17:16471500-16471522 AGGTCTGCAGCTGTGGAAGAAGG - Intronic
1145127113 17:20310727-20310749 TGGCATGCCCCCGTGGAGGGAGG + Intronic
1146604435 17:34246255-34246277 TGGAATGCCACTGTGGAGTATGG + Intergenic
1147439084 17:40436513-40436535 AGGCATGCAGCTGGGGAGTAAGG + Intergenic
1147649071 17:42051624-42051646 TGGCCTGCTGCTGTGGATCAAGG + Intronic
1148179866 17:45596543-45596565 TGTCAGGCAGCAGTGGAGGGAGG + Intergenic
1148634267 17:49135409-49135431 TGGCACGCACCTGTAGAGGCAGG - Intronic
1148793046 17:50184300-50184322 TGGGCTGCAGCTGTGGAGGAGGG + Exonic
1148870632 17:50657033-50657055 TGGCCAGCAGCTGTGCAGGGAGG - Exonic
1149610696 17:57955877-57955899 TGGGACACAGGTGTGGAGGAGGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151661026 17:75518058-75518080 GGGCATGCACCAGTGGATGAAGG + Intronic
1152845706 17:82598530-82598552 TGGCTTGCAGTTCTGGAGGCTGG + Intronic
1153332362 18:3886896-3886918 TGGAACGCAGCTGTGGGGGCTGG + Intronic
1153663607 18:7348400-7348422 TTGCCTGCAGGTGCGGAGGAAGG + Intergenic
1154326517 18:13395431-13395453 TCACATGCAGGTGTGGAGGTGGG + Intronic
1154522792 18:15248008-15248030 TGGAGTGCAGCTGTGGTGGTTGG + Intergenic
1154952849 18:21226839-21226861 TGGCAGGCACCTGTGGTGGCAGG + Intergenic
1156340504 18:36206127-36206149 TTGCTTCCACCTGTGGAGGAAGG + Intronic
1157725073 18:49957981-49958003 TGGCTGGCAGGTGAGGAGGAAGG - Intronic
1159247921 18:65834231-65834253 TGGAATGGAGATGTGTAGGATGG + Intronic
1159571793 18:70122758-70122780 TGACATTCAGCTGAGTAGGATGG + Intronic
1159912393 18:74158524-74158546 TGGAAGGCAGCTGTGAAGAACGG - Exonic
1160189092 18:76700156-76700178 TGGAATGCAGCTGTGGAGCGAGG + Intergenic
1160822831 19:1066420-1066442 TGGAATGCAGCTTGGGAGGCGGG + Intronic
1161054719 19:2184567-2184589 TGGCCTGCGGCTCTGCAGGAGGG - Intronic
1162185530 19:8901850-8901872 TGGGACCAAGCTGTGGAGGAGGG + Exonic
1162185913 19:8904700-8904722 TGGGACCAAGCTGTGGAGGAGGG + Exonic
1163826178 19:19526114-19526136 GCGCCTGGAGCTGTGGAGGAGGG + Intronic
1163836170 19:19575647-19575669 TGGCCTGCAGGTGTGCATGAGGG - Intronic
1166945254 19:46392197-46392219 TGTTATGCAGCTGTGCAGCATGG - Intronic
1167278876 19:48554619-48554641 TGGAATGCAGGTGAGGAGGCTGG - Intronic
1167453362 19:49585144-49585166 TGGGATGGGGCTGTGGGGGAGGG - Intronic
1167966814 19:53154430-53154452 TGACATGAAGCTGTGCAGGTGGG + Intronic
925274849 2:2641429-2641451 AGGCAGACAGCTGTGGAGGTCGG + Intergenic
925439072 2:3868259-3868281 TGCCATGCAGCTGTGCCAGACGG + Intergenic
925682963 2:6442446-6442468 TAGCTTGCAGCTGTGCAGCAAGG + Intergenic
926280054 2:11438725-11438747 TGGCATCTAGGAGTGGAGGACGG - Intergenic
926751834 2:16204298-16204320 TGGCATGGAGCTGGGGAGCTGGG + Intergenic
927131767 2:20066195-20066217 TGGCATGCAGCCATGAAAGAGGG + Intergenic
927186673 2:20487139-20487161 TGGTCTGCAGCCATGGAGGAGGG - Intergenic
927617786 2:24617107-24617129 TGGTATGAAGTTGGGGAGGATGG + Intronic
927854690 2:26520615-26520637 GTGCATGCAGCTATGGAAGAAGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
929552893 2:42905642-42905664 TGGCTTGCACCTGCGCAGGATGG + Intergenic
929922911 2:46185298-46185320 TGGCAAGCTGCGGTGCAGGAGGG - Exonic
930198062 2:48529174-48529196 TGGCATGGTGCTTTGGAGGTTGG - Intergenic
930737425 2:54793815-54793837 TGGAATGCAGCTGTGATGGCTGG + Intronic
932455060 2:71844249-71844271 AGGGATGCAGGGGTGGAGGAAGG - Intergenic
932481396 2:72041677-72041699 TGGGAAGCAGCTGGGGAGGGAGG - Intergenic
932623014 2:73277212-73277234 TGGAGGGCAACTGTGGAGGAGGG - Intronic
933019197 2:77169734-77169756 TGGCTTACAGTTTTGGAGGATGG - Intronic
934972781 2:98776285-98776307 TGGCTTCCAGCTCAGGAGGAAGG - Intergenic
935803471 2:106723422-106723444 AGACATTTAGCTGTGGAGGATGG + Intergenic
936132071 2:109853701-109853723 AGGCATGCATTTCTGGAGGAGGG - Intronic
936212626 2:110517784-110517806 AGGCATGCATTTCTGGAGGAGGG + Intronic
936421764 2:112372364-112372386 AGGCATGCATTTCTGGAGGAGGG + Intronic
936686115 2:114828789-114828811 TGGGATGCAGCTATGCAGGTTGG + Intronic
936758164 2:115739543-115739565 GAGCAAGCAGCTGTAGAGGAAGG - Intronic
937361781 2:121234779-121234801 TGGCAGGAAGGTGTGCAGGACGG + Intronic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937596036 2:123674600-123674622 TGGCTTGCAGTTTTGGAGGGTGG - Intergenic
937790801 2:125959159-125959181 TGACTTGCTGTTGTGGAGGAGGG + Intergenic
938522078 2:132080860-132080882 TGGAGTGCAGCTGTGGTGGTTGG + Intergenic
938711825 2:133981730-133981752 CGGCATGCAGAGGTGGAGGCCGG - Intergenic
939246185 2:139626186-139626208 TGGCATGAAGGTGTGAAGGTGGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940742243 2:157521964-157521986 TGGCATACAGATGAAGAGGAAGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944656122 2:201878283-201878305 TGACATGAAGCTGGGGAGGGTGG - Intronic
946140046 2:217682520-217682542 TGGCATGGAGCTGGCGAGGAGGG + Intronic
947802813 2:232942106-232942128 TGGGATGCAGCCATGCAGGAGGG - Intronic
947967293 2:234291881-234291903 TGGCAGGCATGTGTGGTGGAGGG + Intergenic
948189592 2:236047385-236047407 TGGCCTGGGGCTGTGGAGGGTGG - Intronic
948920691 2:241064632-241064654 TGGCACTCCGCTGTGGAGGGTGG + Intronic
1170716562 20:18836612-18836634 TGGCAGGAAGATGTGGAAGAGGG + Intergenic
1170855864 20:20053304-20053326 TAGCAGGAAGCTGTGGAGGGAGG - Intronic
1171482488 20:25464607-25464629 AGGCAGGCGGCTGTGGAGAAGGG - Intronic
1172702161 20:36860424-36860446 TGGGATACAGCTGTGGACAAGGG - Intronic
1172872260 20:38143119-38143141 TGGGATGAAGGAGTGGAGGAAGG + Intronic
1173270032 20:41525399-41525421 GAGCAGGCAGCTCTGGAGGAGGG - Intronic
1173742059 20:45407999-45408021 TGGGCTGCAGCACTGGAGGAAGG + Exonic
1174471803 20:50767039-50767061 TGGCAAGCAGGGGTGGAGGCGGG + Intergenic
1175939432 20:62531275-62531297 TGGTGGGCAGCTGTGGGGGAAGG - Intergenic
1176774604 21:13120207-13120229 TGGAGTGCAGCTGTGGTGGTTGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1178730632 21:35099505-35099527 GGCCATGCAGCTGTGGAGACAGG + Intronic
1178900804 21:36596989-36597011 TGGCAGGCAGCGGGGGTGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180522221 22:16219923-16219945 TGGAGTGCAGCTGTGGTGGTTGG - Intergenic
1180845053 22:18976312-18976334 TGGCATGTGGCGGTGGAGGGGGG - Intergenic
1181117199 22:20639605-20639627 TGGCTTCCAGCAGAGGAGGATGG - Intergenic
1183094260 22:35542659-35542681 AGGCATGGGGGTGTGGAGGAGGG + Intronic
1183271564 22:36865595-36865617 TAGGATCCAGCTGGGGAGGAAGG - Intronic
1183352359 22:37341362-37341384 TCCTGTGCAGCTGTGGAGGACGG + Intergenic
1183364959 22:37402021-37402043 GGTCACACAGCTGTGGAGGAGGG - Intronic
1183573161 22:38669445-38669467 GGGCATGCAGAAGTGGATGAAGG + Intronic
1184768922 22:46586810-46586832 TGCCCTGCAGCTGATGAGGAGGG + Intronic
1185126084 22:49011601-49011623 GAGCATGCAGCTGGGGAGGAGGG + Intergenic
1185325017 22:50221309-50221331 AGGCGTGCTGCTCTGGAGGAGGG - Exonic
950006909 3:9697279-9697301 TGGCATGCAGATTTGCAGGGTGG - Intronic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951465919 3:23000408-23000430 AAGCATGCAGCTGGGCAGGATGG - Intergenic
951624771 3:24647113-24647135 TGGCTTGCAGTTCTGGAGGCTGG + Intergenic
952991058 3:38831225-38831247 TGGAATGCAGATGTGAAGGTGGG - Intergenic
953142344 3:40240722-40240744 TTGCGTGCTGCTGTGGAGGGTGG - Intronic
953678164 3:45019360-45019382 TGGCATGCACCTGTAGAGCCAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955524507 3:59806758-59806780 TAGAATGCAGCTGTGGAACATGG + Intronic
959537007 3:107497847-107497869 TCAAATGCAGCTGTGGTGGAAGG - Intergenic
960940347 3:122929152-122929174 GGACATGAAGCTGTGAAGGAGGG + Intronic
960991129 3:123312089-123312111 TTGCAGTCAGTTGTGGAGGAGGG - Intronic
961167639 3:124774490-124774512 AGGAATGCAGCTCTGGAGGCTGG + Intronic
961221691 3:125206032-125206054 ATGAATGCAGCTGAGGAGGAAGG - Intronic
961343460 3:126245894-126245916 TGGCCTGCACCTGTGAAGCAGGG + Intergenic
961471245 3:127114525-127114547 TGCCACCCAGCTGTGCAGGATGG - Intergenic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
964845742 3:161042531-161042553 TGGCATGGAACTGGGGAGGGAGG - Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966160103 3:176958718-176958740 TGGAATGCAGATGTGGTGGCTGG + Intergenic
967106218 3:186256821-186256843 TGGCATGGAGATCTGGAGGAGGG - Intronic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969669173 4:8580342-8580364 TGGCAAGAAGCTGTGCAGGCGGG - Intronic
971311590 4:25530011-25530033 TTGCATGCAGGTTTGGAGGAAGG + Intergenic
972045763 4:34663529-34663551 TGGTATGCTGCTGTGGAAGCTGG + Intergenic
973169995 4:47130267-47130289 TGGTATGGGGCTGTGGAGGTGGG - Intronic
977135003 4:93293115-93293137 TGCCGTGCACCTGGGGAGGATGG - Intronic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
981451960 4:144908611-144908633 TTGCTTACAGCTCTGGAGGACGG - Intergenic
982644651 4:158008688-158008710 TGGCAGGCGGATGTGGAGGTTGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
984737653 4:183125824-183125846 TGCCATGCAGCTGGGAATGAGGG - Intronic
985395484 4:189538939-189538961 GGGCAGGCTGCTGTGGAGAAAGG - Intergenic
985928088 5:3033555-3033577 TGGCATGCACCTGGGGATGCCGG + Intergenic
986200546 5:5574527-5574549 TGTCTTGCAGCTCTGGAGGCTGG + Intergenic
986285672 5:6356504-6356526 AGCCACGCAGTTGTGGAGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988066211 5:26230591-26230613 GGGCATGCAGGTGAGGAGGTTGG - Intergenic
988209998 5:28191386-28191408 TGGCACACAACTGTGGAGGTTGG - Intergenic
988361592 5:30242710-30242732 TGGCTTGCAGCTGAGTAGGGAGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
992002831 5:72452153-72452175 TGGCCTGCAGCTGAGGAGAATGG + Intronic
992155240 5:73948878-73948900 TGTCTCGCAGCTGTGGAGGTGGG + Intergenic
993182645 5:84574314-84574336 TGGCTTGCAGTTCTGGAGGCTGG + Intergenic
993220607 5:85091915-85091937 TTGCTTACAGCTCTGGAGGATGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993464633 5:88230057-88230079 TGGCATGCACCTGTGGTCGGGGG + Intronic
993877767 5:93328015-93328037 TGGCAGGCAGGTGTGGAGAATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994091652 5:95814915-95814937 TGCCATCCAGCTCTTGAGGAGGG + Exonic
994135878 5:96285555-96285577 TGGCATGAAGCTGCTGAGAAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995509297 5:112892281-112892303 TGGAATGGAGCAGTGCAGGAGGG + Exonic
996058181 5:119003064-119003086 AGGCATGAAGCTGTGAAGGAAGG - Intergenic
997214874 5:132102157-132102179 TGGCCTGCAGCTGGGGAGGCAGG + Intergenic
998023339 5:138790133-138790155 TGAAATGGAGCTGTGCAGGAAGG + Intronic
998040355 5:138947477-138947499 TGGCCTGCGGCTGTGGCGGATGG - Intronic
998672503 5:144369382-144369404 TGGCAGCCAGCGGTGGAGGCAGG + Intronic
1000018731 5:157300937-157300959 TGACAGGCAGCCCTGGAGGAGGG - Intronic
1000088548 5:157910238-157910260 TGTCATGCACCTATGGAGCAGGG - Intergenic
1000375076 5:160573248-160573270 TGGAAGGCAGCTGTCCAGGAAGG + Intronic
1000440648 5:161259332-161259354 TTTCCTGCAGCTGTGGAGGATGG - Intergenic
1000479266 5:161751399-161751421 TGCCATCCAGCTCTTGAGGAGGG + Intergenic
1001275184 5:170345492-170345514 TTTCATGTAGCTGTGGAGGAAGG - Intergenic
1001933100 5:175687026-175687048 ATGCATGCAGCCGTGGAGGCAGG + Intergenic
1002033054 5:176445073-176445095 TGCCTTTTAGCTGTGGAGGATGG - Intergenic
1002850913 6:995658-995680 TGGCAGGAAGCAGTTGAGGATGG - Intergenic
1004254626 6:14051559-14051581 TGCCATGTAGCTGTGCAGGGTGG + Intergenic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005667370 6:28071691-28071713 TGGCATGCACCTGTAGCGGGAGG + Intergenic
1006656402 6:35597376-35597398 TGGAAGGCCGCTGTGGTGGAAGG - Exonic
1006902141 6:37510082-37510104 TGGCTTGCAGTTCTGGAGGCTGG + Intergenic
1007074342 6:39057370-39057392 TGGCATGCAGCCTCCGAGGAGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016244377 6:141965382-141965404 AGGTATGCAGGTGTGGAGCAGGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016449951 6:144172298-144172320 AGTCATGCAGCTGTAGAGGTGGG + Intronic
1016754260 6:147666479-147666501 TGACAGGGAGCTGAGGAGGAAGG - Intronic
1019372997 7:673111-673133 TGGCCAGCAGCTGTGGACCAGGG + Intronic
1019730404 7:2626668-2626690 TGGCCCGCAGCTCTGGAGGCTGG - Intergenic
1019942070 7:4299491-4299513 TTGCCTGGAGCTGGGGAGGAGGG + Intergenic
1020882792 7:13783347-13783369 TAACAAGGAGCTGTGGAGGATGG - Intergenic
1021530982 7:21644672-21644694 TTACCTGCAGCTGAGGAGGAAGG + Intronic
1021565700 7:22014409-22014431 TAGCATCCAGCTTTGTAGGATGG + Intergenic
1022369811 7:29759824-29759846 TGGCTTACAGTTGTGGAGGTTGG - Intergenic
1022823241 7:33981925-33981947 TGGCAGGAAGCTGTGGTGGCAGG + Intronic
1023108639 7:36788174-36788196 TGGTAAGCTGCTGAGGAGGAAGG + Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023458866 7:40371449-40371471 AGGAATGCAGCTGTGGAGTCCGG + Intronic
1023872070 7:44268675-44268697 TGGCATGGAGCTCTGAGGGATGG + Intronic
1024181281 7:46897610-46897632 TGGTAAGCAGATGTGGAGAAGGG + Intergenic
1025195086 7:56926358-56926380 TGGCATGCAGCTGGAGCTGAGGG - Intergenic
1025676866 7:63650585-63650607 TGGCATGCAGCTGGAGCTGAGGG + Intergenic
1025855053 7:65269326-65269348 AGGCACGCAGTTGGGGAGGAGGG + Intergenic
1026276677 7:68884878-68884900 TGGCTTACAGCTCTGGAGGCTGG + Intergenic
1027571201 7:79869403-79869425 TTGAATGCTGCTGTAGAGGAAGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028687729 7:93611333-93611355 GTGCAGGCAGCTGTGGATGAAGG + Intronic
1028884164 7:95912677-95912699 TGCCAGGCAGCTTTGGAGGCGGG + Intronic
1029264208 7:99325775-99325797 AGGCAGGCTGCAGTGGAGGAGGG - Intergenic
1029472610 7:100764056-100764078 AAGCATGCAGCTGTCGAAGAAGG - Exonic
1029599489 7:101555453-101555475 TGACAGGCAGCTATGGTGGAAGG + Intronic
1029673371 7:102049273-102049295 TGGCACGCAGCTGTTGCTGAAGG - Intronic
1029693625 7:102199033-102199055 GGGCAGGCAGCTCGGGAGGAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031388125 7:121178135-121178157 TGGCATGCAGCCTCTGAGGAGGG + Intronic
1032083506 7:128871566-128871588 TCCCCTGCAGCTGTGGAGGAAGG + Intronic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032109992 7:129067922-129067944 TGGAATCCAGATGTAGAGGAGGG + Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033118311 7:138645546-138645568 TGGCATATTGCTGTGGAGGCTGG - Intronic
1033232250 7:139609190-139609212 TGGCATGGGGCTTGGGAGGATGG + Intronic
1033243399 7:139699594-139699616 GGGCCTGCAGCTGGGGAGGGTGG + Intronic
1033566226 7:142580818-142580840 TAGCATTCACCTTTGGAGGAAGG + Intergenic
1034472568 7:151263335-151263357 TGGAAGGCAGCTGGGGAGGTTGG + Intronic
1035342454 7:158172647-158172669 TGGGATGCTGCTGTGGATGGTGG - Intronic
1035342510 7:158172978-158173000 TGGGATGCTGCTGTCGATGATGG - Intronic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1038975426 8:32690447-32690469 TGGCATACATCTCTGGAGGATGG - Intronic
1039550827 8:38441655-38441677 TGCCCTGCGGCTATGGAGGAGGG + Intronic
1040891933 8:52326254-52326276 TGGCCTGCAGCAGTGGGGAAGGG + Intronic
1041938725 8:63363405-63363427 TGGCATGTGGCTGCAGAGGAGGG + Intergenic
1041974752 8:63784839-63784861 TGGCATGTGGCTGTGCATGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042348299 8:67750124-67750146 AGCCATGCAGATGTGGAGTAGGG - Intergenic
1042985798 8:74581572-74581594 TGGCATGTAGCTGGGGAGTGAGG + Intergenic
1043783065 8:84361466-84361488 GAGCATGCTGCTGTGGAGGATGG + Intronic
1045426779 8:102074988-102075010 TGGGATGCAGCTGTGATGCATGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1047534178 8:125704209-125704231 TGGGATGCAACTCTGGAGGGGGG - Intergenic
1047629796 8:126694441-126694463 GGCTATGCATCTGTGGAGGACGG - Intergenic
1048805824 8:138240418-138240440 TGGGAGGCAGCTGTGGAGTGAGG - Intronic
1049009762 8:139879535-139879557 TGGGATGGTGTTGTGGAGGAGGG - Intronic
1050190163 9:3016507-3016529 TGGCATTCCCCTGTGCAGGAGGG - Intergenic
1051796130 9:20872537-20872559 AGGCATGCAGAAGAGGAGGAGGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053700773 9:40687990-40688012 TGGAGTGCAGCTGTGGTGGTTGG + Intergenic
1054312066 9:63487388-63487410 TGGAGTGCAGCTGTGGTGGTTGG + Intergenic
1054410840 9:64811445-64811467 TGGAGTGCAGCTGTGGTGGTTGG + Intergenic
1055449829 9:76420804-76420826 TGGCATGCAGCTGTGGTCCCAGG + Intronic
1056800420 9:89686978-89687000 TGGCATGCAGGGTTGGATGAAGG - Intergenic
1057164203 9:92913533-92913555 GTGCATGCGGATGTGGAGGATGG + Intergenic
1057276292 9:93677508-93677530 TGGCATGCCGGTGGGGGGGAGGG - Intronic
1057306396 9:93914729-93914751 TGGGATGCAGCTGTGGTCTAGGG - Intergenic
1057502254 9:95605055-95605077 TGGCATGTGGCTGTGGTGGCCGG + Intergenic
1057933633 9:99218234-99218256 ACACGTGCAGCTGTGGAGGAGGG + Exonic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1059496584 9:114714863-114714885 TGGCAGGCACCTGTGGTGGCAGG - Intergenic
1059534720 9:115070063-115070085 TGGGATTCAGCAGTGGATGATGG + Intronic
1060184960 9:121558639-121558661 TGGCAGGGAGGTGTGGAGGTGGG - Intergenic
1060196108 9:121624325-121624347 AGGCATGCACCTGAGGAGCAGGG + Intronic
1060547222 9:124468590-124468612 GGGGCTGCTGCTGTGGAGGAAGG + Exonic
1060648233 9:125300944-125300966 TGGCATGTTGCTGTTGAGAATGG + Intronic
1060838221 9:126774018-126774040 TTGCTTGCAGATGTGGAAGAAGG - Intergenic
1060890473 9:127184829-127184851 TGGGAGGCAGCTGTGGCAGAGGG - Intronic
1061593916 9:131616409-131616431 AGACATGCAGTTGAGGAGGATGG - Intronic
1061888587 9:133605893-133605915 AGGCAGGAAGCTGGGGAGGAAGG - Intergenic
1062033023 9:134370642-134370664 TGGCTTGCAGGTGGCGAGGAAGG - Intronic
1062136747 9:134933149-134933171 TGGCAGGCCCCTCTGGAGGATGG + Intergenic
1062646364 9:137550599-137550621 GGGGATGCAGCTGGGGAGGAGGG + Intergenic
1062674429 9:137732129-137732151 TGGCAAGCAGCAGTGGAGCCAGG - Intronic
1185891034 X:3822315-3822337 TGGGAGGCAGCTGTGTAGGCAGG + Intronic
1185896138 X:3860731-3860753 TGGGAGGCAGCTGTGTAGGCAGG + Intergenic
1185901257 X:3899157-3899179 TGGGAGGCAGCTGTGTAGGCAGG + Intergenic
1187064061 X:15815746-15815768 TGGAATGGAGCAGTGCAGGAGGG + Exonic
1187740990 X:22355362-22355384 GGGGATGCAGCGCTGGAGGAAGG + Intergenic
1188835362 X:34948199-34948221 TGGCATAGAGATGTGGAGGGTGG - Intergenic
1189171840 X:38916734-38916756 TGGCAGGCAGCTGTGGGCCAGGG + Intergenic
1191108666 X:56788498-56788520 TTACATGCAGCTGTGGAGCCAGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193328354 X:80207807-80207829 TGGCAAGGAGCAGTGGAGGTAGG + Intergenic
1193675356 X:84445602-84445624 GGGTAAGGAGCTGTGGAGGAGGG + Intronic
1194057351 X:89151856-89151878 TGGCATGCATTGGTGGGGGAAGG + Intergenic
1194270019 X:91801045-91801067 TGGCATGCGGCTGTAGACCAAGG + Intronic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1198138960 X:133783494-133783516 TGGCCTGCAGCTGAGCAAGAAGG + Intronic
1199100763 X:143797005-143797027 TGGGATGCAGCAGTTGAGGAAGG + Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1199644912 X:149898753-149898775 TGGCAGTGAGCTGTGGAGGGAGG - Intergenic
1200587261 Y:5022485-5022507 TGGCATGCGGCTGTAGACCAAGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic