ID: 1104485734

View in Genome Browser
Species Human (GRCh38)
Location 12:129149975-129149997
Sequence ATGTATGCCCAGCAACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104485730_1104485734 1 Left 1104485730 12:129149951-129149973 CCAGTGCTCTTTGTCTGAAACCT 0: 1
1: 1
2: 1
3: 14
4: 238
Right 1104485734 12:129149975-129149997 ATGTATGCCCAGCAACAGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 157
1104485729_1104485734 2 Left 1104485729 12:129149950-129149972 CCCAGTGCTCTTTGTCTGAAACC 0: 1
1: 0
2: 1
3: 23
4: 184
Right 1104485734 12:129149975-129149997 ATGTATGCCCAGCAACAGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104485734 Original CRISPR ATGTATGCCCAGCAACAGAG GGG Intronic
900681859 1:3920724-3920746 CTGTATCCCCAGCTACATAGGGG - Intergenic
900792535 1:4689840-4689862 GCGGATGCCCAGCAGCAGAGGGG + Intronic
900837398 1:5015816-5015838 AGAGATGCCCAGCAACAGAAGGG + Intergenic
902561809 1:17282287-17282309 ATGTAGACACAGAAACAGAGAGG - Intronic
903495033 1:23760180-23760202 AGGAATGCACAGCAACAGTGGGG - Exonic
905270993 1:36787366-36787388 GTGGATGCCCAGCACCAGACAGG - Intergenic
906938669 1:50236680-50236702 ATGGATAACCAGCCACAGAGAGG - Intergenic
910890577 1:92015175-92015197 ATGTAGTCCCAGCTACATAGAGG + Intergenic
912272344 1:108224085-108224107 ATGCATGCCAAGAAACAGAGGGG + Intronic
912295877 1:108470236-108470258 ATGCATGCCAAGAAACAGAGGGG - Intronic
912602776 1:110954766-110954788 AAGAATGCACAGAAACAGAGTGG - Intronic
917169109 1:172149853-172149875 ATGTATCCCCATCCACAGAAAGG - Intronic
919237883 1:194869698-194869720 AAATTTGCCCAGAAACAGAGAGG + Intergenic
921892719 1:220369151-220369173 ATATGTAGCCAGCAACAGAGAGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
1064091050 10:12385232-12385254 ATGTATACCTAGGAACAGAATGG - Intronic
1068743763 10:60504782-60504804 ATCAATGCCAAGAAACAGAGAGG + Intronic
1069640994 10:69955479-69955501 ATGTATGGTGAGGAACAGAGAGG - Intronic
1070715789 10:78720074-78720096 ATGAATGCACAGCATCAGTGGGG - Intergenic
1070793287 10:79202555-79202577 AGGTCTTCCCAGCACCAGAGGGG - Intronic
1070970171 10:80558600-80558622 CTGTAGTCCCAGCAACTGAGAGG - Intronic
1074884889 10:117685687-117685709 ATCCATGCCCAGGAACTGAGGGG - Intergenic
1075250980 10:120872911-120872933 ATTCATGCAAAGCAACAGAGTGG - Intronic
1075660074 10:124187307-124187329 ATGTGTTACCAGCAACAGTGGGG - Intergenic
1078786672 11:14500870-14500892 ATGAATGCACAGAATCAGAGAGG - Intergenic
1079245240 11:18747271-18747293 CTGTAGTCCCAGCAACACAGGGG - Intronic
1082783467 11:57303672-57303694 ATGTTTGCCAAGCAAATGAGGGG + Intronic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1085174341 11:74473447-74473469 ATGTCTGGCTAGCAACAGTGAGG + Intergenic
1089492665 11:118893651-118893673 ATCTCTGCCCTGCCACAGAGGGG + Exonic
1091222073 11:133935656-133935678 CTGTGTGCCCAGCAACAGCCTGG - Exonic
1094571422 12:31644543-31644565 CTGTATGTGCAGCAACAGATAGG - Intergenic
1096402208 12:51316650-51316672 ATCTATGACAAGCAACAGTGTGG - Intronic
1097029632 12:56081475-56081497 ATTTAGGCCCAGCAACTGTGAGG - Intronic
1101177688 12:102172485-102172507 ATATCTGCTCAGCAACACAGTGG - Intronic
1101424340 12:104575706-104575728 AAGGATGCCGAGCCACAGAGTGG + Intronic
1104118237 12:125771492-125771514 AGGTCTCCCCAGAAACAGAGCGG - Intergenic
1104485734 12:129149975-129149997 ATGTATGCCCAGCAACAGAGGGG + Intronic
1105037965 12:132940228-132940250 AGGGATGCACAGCCACAGAGGGG + Intronic
1105687382 13:22798050-22798072 ATTTATGCCCAACAAAATAGGGG - Intergenic
1108676736 13:52743572-52743594 AGGTGGGCCCAGCAGCAGAGTGG - Intergenic
1110511964 13:76361393-76361415 AAGCATCCCTAGCAACAGAGAGG + Intergenic
1116568756 14:46487721-46487743 ATGTGGACCCGGCAACAGAGAGG - Intergenic
1116674309 14:47886048-47886070 ATGTATGCACATAAAAAGAGAGG - Intergenic
1118751528 14:68811279-68811301 AAGTATCCCAAGCAAGAGAGAGG + Intergenic
1119307955 14:73623029-73623051 CTGTATTCCCAGCTACAGGGAGG - Intergenic
1120614401 14:86685221-86685243 ATGTATACCTAGGAACAGAATGG + Intergenic
1122069548 14:99196685-99196707 ATGTTTGTCCACCATCAGAGAGG + Intronic
1122262858 14:100533054-100533076 ATGTGTGCCCAGCACAGGAGTGG - Intergenic
1122710987 14:103658011-103658033 ATGGAAGCCAAGCTACAGAGGGG - Intronic
1123110739 14:105865896-105865918 TTGTTTTCCCAGCAGCAGAGAGG + Intergenic
1124897574 15:33791320-33791342 ATTCATCCCCAGCAACAGACAGG + Intronic
1125099718 15:35897951-35897973 ATGTCTGAGAAGCAACAGAGTGG - Intergenic
1125761314 15:42097402-42097424 AAGGATGCCCAGCAAGGGAGAGG - Intergenic
1127671710 15:61200996-61201018 ATTTTTCCACAGCAACAGAGTGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128572725 15:68747049-68747071 TTGTATTCCCAGCTACTGAGGGG - Intergenic
1128902427 15:71436738-71436760 ATGAATGCCCAGCAACCCAATGG + Intronic
1129718108 15:77863492-77863514 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1129987538 15:79931527-79931549 ATATATGCCCCCCAACAGTGTGG - Intergenic
1130460807 15:84157279-84157301 CTGTATGCCCAGCACCAGGCTGG + Intergenic
1134516817 16:14894290-14894312 CTGTCTGCCCAGCAAAAGGGAGG + Intronic
1135459908 16:22633214-22633236 CTGTAGGCCCAGCTACAGGGAGG - Intergenic
1138209263 16:55149361-55149383 ATATATGCCCTATAACAGAGAGG - Intergenic
1147451764 17:40510170-40510192 ATCTGTGCCCAGAAACAGATAGG + Intergenic
1147760384 17:42794381-42794403 ATGTATGCACACATACAGAGGGG - Intronic
1151067937 17:71173195-71173217 CTGTATGCCCAACAACTAAGTGG - Intergenic
1151518968 17:74615001-74615023 ACGAATCTCCAGCAACAGAGAGG - Intronic
1152126150 17:78448240-78448262 TTGTATTCCCAGCTACAGGGAGG + Intronic
1152161248 17:78669890-78669912 ATGTGTGCCCAGCCCCAGTGAGG + Intergenic
1153038620 18:789116-789138 ATGAATGCCAAACAACAGTGTGG - Intronic
1154370623 18:13758914-13758936 TTGTATCTCCAGGAACAGAGAGG + Intronic
1157204731 18:45688441-45688463 AGTTATGTCCAGCAAAAGAGAGG + Intergenic
1157400540 18:47383025-47383047 CCATAAGCCCAGCAACAGAGAGG + Intergenic
1157576764 18:48748894-48748916 AGGGCTGCCCCGCAACAGAGGGG - Intronic
1157626952 18:49058928-49058950 ATGTATGCTCAGCACAAAAGGGG + Intronic
1157743087 18:50110385-50110407 AGGTATGCCCAGCAGCTGATAGG + Intronic
1157762999 18:50277976-50277998 ATGTATCCCCTGCACGAGAGGGG - Intronic
1159436766 18:68428260-68428282 ATTAATGACCAGCAACAGTGAGG - Intergenic
1160030974 18:75259747-75259769 ATGTATCCCCTGCAACTAAGGGG + Intronic
1163698367 19:18775201-18775223 ATCTTTGCCCACCTACAGAGCGG + Intronic
1164947503 19:32308905-32308927 ATGTATGGACAGCCACAGTGGGG - Intergenic
927338680 2:21954552-21954574 ATCTATGCCCACCAACCCAGGGG - Intergenic
928090699 2:28372979-28373001 AAGAATGCCCAGCCCCAGAGTGG + Intergenic
928893969 2:36239937-36239959 CTGTTTGCCAAGTAACAGAGAGG + Intergenic
930260539 2:49141056-49141078 ATGTATGCCTATCTATAGAGTGG - Intronic
932619993 2:73259598-73259620 ATGAATGGCAAGGAACAGAGTGG + Intronic
932837782 2:75053475-75053497 AGGTATGGGGAGCAACAGAGAGG - Intronic
933702345 2:85264374-85264396 ATGCATGCACAGCACCAGACTGG - Intronic
935757832 2:106290620-106290642 AGGACTGCCCAGCAACAGGGCGG + Intergenic
937457773 2:122057870-122057892 ATGCAGGCACAGCAACAGGGTGG - Intergenic
939998468 2:148942806-148942828 ATATCTGCCCACCAACCGAGGGG + Intronic
941265613 2:163357946-163357968 ATGTATGCCAAGCCAAAGAGTGG - Intergenic
944642601 2:201743421-201743443 AGCTATGCCCAGCTACAAAGAGG - Intronic
946462474 2:219881369-219881391 CTGTAGTCCCAGCAACTGAGAGG + Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1171254629 20:23680126-23680148 ATGTCTGCACAGCAATGGAGGGG + Intergenic
1173136326 20:40442438-40442460 ATGTGTCCCCAGCCACAGAGTGG + Intergenic
1173886061 20:46459638-46459660 ATGAAAGCCAAGCAACATAGTGG + Intergenic
1178104395 21:29301351-29301373 ATGTTCCCCCAGCAACAAAGGGG - Intronic
1178337091 21:31752905-31752927 ACTTAAGCCCAGCACCAGAGAGG + Intergenic
1184872885 22:47251998-47252020 ATGTAGGCACAGCTACACAGTGG - Intergenic
954290397 3:49646892-49646914 AGGCATGTCCAGCAACAGGGAGG + Intronic
956798023 3:72733396-72733418 TTGTATCCCCTGCACCAGAGTGG - Intergenic
962939039 3:140108907-140108929 ATTTATGCCCTGTCACAGAGGGG + Intronic
963047899 3:141116629-141116651 ATGAATGGCCAGCTACAGACTGG - Intronic
967298798 3:187991721-187991743 ATGTATGCCAAACAAGACAGTGG + Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
969179456 4:5425957-5425979 ATGTATATCCAGCAACAGGAAGG - Intronic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
980864592 4:138540263-138540285 AAGGCTGCCCAGCTACAGAGTGG - Intergenic
981544203 4:145877936-145877958 ATGTATGAGCAGCAATGGAGTGG + Intronic
981960958 4:150538385-150538407 CTAGATGCCCAGCAACAGTGGGG + Intronic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
983474357 4:168196104-168196126 ATCTATGTCCAGGAACAGTGGGG - Intergenic
984646954 4:182230905-182230927 AGGTTTCCCCAGCAACGGAGTGG + Intronic
986433378 5:7704040-7704062 ATGAAAGGGCAGCAACAGAGAGG + Intronic
990167564 5:53011453-53011475 AAGGATGACCAGCAACATAGCGG - Intronic
990833644 5:59989427-59989449 ATGCATGCCCATGAAGAGAGAGG + Intronic
993308205 5:86295907-86295929 ATGCATGCCAAGAAACAGAGGGG - Intergenic
994416771 5:99482134-99482156 ATAAATGCCCATCAACTGAGTGG + Intergenic
994463199 5:100093023-100093045 ATAAATGCCCATCAACTGAGTGG - Intergenic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
997368884 5:133343407-133343429 AGGTGTTCCCAGGAACAGAGAGG - Intronic
1000320210 5:160128671-160128693 ATGTAATCCCAGCTACTGAGAGG + Intergenic
1000497693 5:162006256-162006278 ATGTATGACCAGAAACAATGAGG + Intergenic
1000992579 5:167926279-167926301 ATATATGCAAAACAACAGAGAGG - Intronic
1002436656 5:179235753-179235775 ATGGGGGCCCAGCAACAGAGAGG - Intronic
1003312889 6:4984857-4984879 AAGAATGCACACCAACAGAGAGG - Intergenic
1007298267 6:40845444-40845466 GGGTGTGCACAGCAACAGAGAGG + Intergenic
1007836227 6:44676099-44676121 ATGTATGCTCAGCAAATGACAGG + Intergenic
1009032859 6:58081317-58081339 ATGAATGCACACCAACAGAGTGG - Intergenic
1009208475 6:60833091-60833113 ATGAATGCACACCAACAGAGTGG - Intergenic
1009977119 6:70683064-70683086 ATGAATACCCAGTAACAGACTGG - Intronic
1013866012 6:114697166-114697188 ATGTGTGCCCAGCACCAAATAGG + Intergenic
1021539870 7:21745642-21745664 ATGTAAGCTCAACTACAGAGGGG - Intronic
1021854213 7:24837904-24837926 ATATGTGCCCAGCAACACTGTGG + Intronic
1023526823 7:41113010-41113032 GAGTATGCCCAGAAACAGAGTGG - Intergenic
1024184642 7:46937971-46937993 ATGTAAGCCCAGCTACACAGAGG + Intergenic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1028333149 7:89621913-89621935 ATCTATGCCCAGGAAGAGTGGGG - Intergenic
1031138073 7:117907601-117907623 ATGTATGCCCAGGGACATAAAGG - Intergenic
1034153479 7:148935523-148935545 TGGGATGCCCAGCAACAGAAGGG + Intergenic
1036787623 8:11698453-11698475 ATGACTGGCCAGCAGCAGAGAGG - Intronic
1038121116 8:24616497-24616519 AAGTCTGCCAAGCCACAGAGAGG - Intergenic
1038218190 8:25582157-25582179 ATCTATGCCAAGCAACCTAGAGG - Intergenic
1039682944 8:39762219-39762241 ATGAATGCTCAATAACAGAGTGG + Intronic
1042616292 8:70653672-70653694 CTGTATGCCCAGCAAAATAGAGG - Intronic
1044070476 8:87753732-87753754 ATGTATAGGCAGCAACTGAGGGG - Intergenic
1045698583 8:104839442-104839464 CTGTAATCCCAGCTACAGAGTGG - Intronic
1047798930 8:128288670-128288692 ATATATGCAAAGAAACAGAGGGG - Intergenic
1049421417 8:142518249-142518271 ATGCATGCCCAGCACCTGGGCGG - Intronic
1050397022 9:5209622-5209644 CTATGTGCCCAGCAACAGAATGG + Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1053482119 9:38423665-38423687 ATGTTTGCCCAGCAGGAGACTGG - Intronic
1058716324 9:107725456-107725478 TTGTATGCATAGCAACAAAGAGG + Intergenic
1059237867 9:112777852-112777874 ATGTCTGCCTAGCAAATGAGGGG - Intronic
1059475882 9:114547249-114547271 CTGTATGCAAAGCCACAGAGAGG + Intergenic
1059761100 9:117338484-117338506 ATGTGTGCCCAGCACAAGATGGG - Intronic
1062068951 9:134544956-134544978 AGCCAGGCCCAGCAACAGAGGGG + Intergenic
1189752139 X:44233113-44233135 ATATATGCCCAGCAGCATACTGG + Intronic
1189919392 X:45888685-45888707 TGCTTTGCCCAGCAACAGAGGGG - Intergenic
1190650998 X:52568689-52568711 ATGTATGGCAAGCACCAAAGTGG - Intergenic
1191774028 X:64793090-64793112 ATGTATGCCCAGGAAGAATGGGG - Intergenic
1193026629 X:76852037-76852059 ATGTATGCCCAGGAAAAGTGGGG + Intergenic
1195041680 X:101020556-101020578 ATGTATGCTGAGCCAGAGAGAGG + Exonic
1197698650 X:129578695-129578717 ATGTTTGCCCATGAACAGAAAGG + Intronic
1198766457 X:140084801-140084823 CTGTAGTCCCAGCTACAGAGAGG + Intergenic
1202192368 Y:22258525-22258547 ATGTATCCCCAGATACAGCGAGG - Intergenic
1202378443 Y:24257901-24257923 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1202492339 Y:25412220-25412242 CTGTATGCCCAGCACCAGGCTGG + Intergenic