ID: 1104487565

View in Genome Browser
Species Human (GRCh38)
Location 12:129164485-129164507
Sequence GAAAATGGACCAATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 917
Summary {0: 1, 1: 6, 2: 48, 3: 237, 4: 625}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104487565_1104487568 7 Left 1104487565 12:129164485-129164507 CCCAGCTGTATTGGTCCATTTTC 0: 1
1: 6
2: 48
3: 237
4: 625
Right 1104487568 12:129164515-129164537 TATAAAGAACTGCCCAAGACTGG 0: 307
1: 577
2: 1315
3: 3452
4: 8374
1104487565_1104487572 21 Left 1104487565 12:129164485-129164507 CCCAGCTGTATTGGTCCATTTTC 0: 1
1: 6
2: 48
3: 237
4: 625
Right 1104487572 12:129164529-129164551 CAAGACTGGGTAATTTATAAAGG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
1104487565_1104487569 8 Left 1104487565 12:129164485-129164507 CCCAGCTGTATTGGTCCATTTTC 0: 1
1: 6
2: 48
3: 237
4: 625
Right 1104487569 12:129164516-129164538 ATAAAGAACTGCCCAAGACTGGG 0: 289
1: 584
2: 1416
3: 5878
4: 9698
1104487565_1104487573 28 Left 1104487565 12:129164485-129164507 CCCAGCTGTATTGGTCCATTTTC 0: 1
1: 6
2: 48
3: 237
4: 625
Right 1104487573 12:129164536-129164558 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104487565 Original CRISPR GAAAATGGACCAATACAGCT GGG (reversed) Intronic
900723550 1:4198290-4198312 GAAACTGGACTAATACTGTTAGG - Intergenic
900939805 1:5791449-5791471 GAGAATGGACTAATACAGGCAGG + Intergenic
901185512 1:7370261-7370283 AAACATGGAACAATGCAGCTTGG + Intronic
901767236 1:11510795-11510817 GAAAAGGAACTAATACAGATGGG - Intronic
901873608 1:12153163-12153185 GAAAAGGGACCAAGGCACCTTGG - Intergenic
902268628 1:15287302-15287324 GAGAATGGACTAATACATCTGGG - Intronic
902740351 1:18433581-18433603 GAAAACGGACTAATACAGGGAGG + Intergenic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903146673 1:21377211-21377233 GAAAATGAACTAATAAAGATGGG + Intergenic
904313503 1:29644861-29644883 GAGAATGGACTAATACAGGAAGG - Intergenic
905290396 1:36917765-36917787 GAAAACGGACTAATACAGGGAGG + Intronic
906310062 1:44747468-44747490 GAAAATGTAACAATCCAGGTAGG + Exonic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
907625427 1:56024680-56024702 GAGAACAGACTAATACAGCTGGG + Intergenic
907721066 1:56972708-56972730 GAAAATGGACTAATACAGATAGG + Intergenic
907726057 1:57021684-57021706 GAGAATGGACTAATACACCCAGG + Intronic
908048891 1:60205991-60206013 GAAAATGGACTAATACAATGTGG + Intergenic
908068629 1:60434330-60434352 TAAAAGGGACCAGTATAGCTTGG - Intergenic
908076245 1:60522584-60522606 GAAAGTGGACTAATACAACATGG - Intergenic
908211434 1:61904577-61904599 GAGAATGGACTAATACAGAAGGG - Intronic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
908562459 1:65320354-65320376 GAAAATAGAGCAATATATCTAGG - Intronic
908967693 1:69786481-69786503 GAAAATAGACTAATACAGGGAGG - Intronic
909510911 1:76451170-76451192 GAGAATGGACTAATACAGATGGG - Intronic
909525118 1:76613887-76613909 GAGAATGGACTAATACAGTAAGG + Intronic
909529563 1:76667218-76667240 GAGAATGGACTAATTCACCTGGG - Intergenic
909751522 1:79166685-79166707 GAGAATGGACTAATATAGATGGG + Intergenic
909866870 1:80685242-80685264 GAAAATGAACTAATACAGTGGGG - Intergenic
910105887 1:83630620-83630642 GAAAATTGACTAATACAGATAGG + Intergenic
910621197 1:89257087-89257109 GAAAATGGACTAATATACTTAGG - Intergenic
910860625 1:91739695-91739717 GAGAATGGACTAATGCAGCAGGG - Intronic
911268997 1:95777717-95777739 GAAAACAGACTAATACAGGTGGG - Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911760456 1:101608550-101608572 GAGAATGGACTAATACACTTAGG + Intergenic
911964609 1:104350593-104350615 GAACATGGCTCACTACAGCTTGG - Intergenic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
912315809 1:108666872-108666894 CAAAATGGACTAATACAGAGAGG + Intergenic
912696547 1:111846526-111846548 GACAATGGAGCTAGACAGCTTGG + Intronic
912902446 1:113667038-113667060 AAAAATGGAACAATAAAGCCTGG - Intronic
913242231 1:116839029-116839051 GAAAAAGGACTAATACAGAGAGG + Intergenic
913316441 1:117557880-117557902 GAAAATGAACTAATACAGAGGGG - Intergenic
913370187 1:118090094-118090116 GAAAATGGACTAATACAATGGGG + Intronic
913490506 1:119375607-119375629 GAAAATGGACTAATACAATCAGG - Intronic
914977835 1:152381778-152381800 GTAAATGGAACAGTAAAGCTTGG + Intergenic
915352911 1:155237613-155237635 GAAAGTGGACCAGACCAGCTGGG + Intronic
916341322 1:163739047-163739069 GAAAATGGACTAGTACAGCTGGG - Intergenic
916512347 1:165483453-165483475 GAGAATGGACTAATACACTTGGG - Intergenic
918073350 1:181150161-181150183 GAAAATGGACTAAGACAAATGGG - Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918466591 1:184827213-184827235 GAAAACGGACTAATACAGTGGGG + Intronic
919133267 1:193477142-193477164 GAAAATAGACTAATACAGGGTGG + Intergenic
919160657 1:193825894-193825916 GAGAATGGACTAATACACCATGG + Intergenic
919584236 1:199416274-199416296 GAAAATGGACTAATACAGGGAGG + Intergenic
920734401 1:208517718-208517740 GAAAATGAACTAATACAGATTGG - Intergenic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921362556 1:214343322-214343344 GAAAATGGACTAATACCATTAGG + Intergenic
921408311 1:214806536-214806558 GGAAATGGAACAACAAAGCTTGG + Intergenic
921457363 1:215388657-215388679 GAGAATGAACTAATACAGCTGGG - Intergenic
921894062 1:220380548-220380570 GAAAATGGACTAATATACCTGGG + Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922877933 1:228955452-228955474 GAAAATGGACTAAGACAGAAAGG + Intergenic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923802616 1:237225286-237225308 GAAAACGGACGAATACAGGTGGG - Intronic
924702291 1:246466306-246466328 GAAAATGTACCTATACACCATGG + Intronic
1063303294 10:4873375-4873397 GAAAATGGACTAATACAGTCAGG + Intergenic
1063909174 10:10812072-10812094 GAAAATGGACTAATATAGGTGGG - Intergenic
1064210816 10:13359367-13359389 GAAAATAGACCACTGCAGCCGGG + Intergenic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065440921 10:25752659-25752681 GAAAATGGACTAATACAAGGGGG + Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1066247681 10:33599300-33599322 AAAAATAGACTAATACAGGTTGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1067318521 10:45195524-45195546 AAGAATGGATCAATACAGTTGGG + Intergenic
1068049187 10:51927460-51927482 GAAAATGGACTAATACAATAGGG + Intronic
1068218754 10:54016294-54016316 GAAAATGGAACAAAGCAGTTTGG + Intronic
1068229691 10:54156274-54156296 GAAAACAGACTAATACAGATGGG - Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069155358 10:65022989-65023011 CACAATGGACAAACACAGCTTGG - Intergenic
1069338489 10:67382636-67382658 GCAAATGGACCAACACAGGGAGG - Intronic
1069810119 10:71152960-71152982 GCAAATGGACCAAAGCAGCAAGG + Intergenic
1070922296 10:80195642-80195664 GAAAATGGACTAATACAAGGTGG - Intronic
1071723306 10:88169423-88169445 GAAAATGGACTAATACCACTGGG - Intergenic
1072322009 10:94259737-94259759 GAAAATGGACTAATATAGTCGGG - Intronic
1072836263 10:98716889-98716911 ATAAATGGAACAATACAGCCTGG - Intronic
1072840664 10:98770800-98770822 GAAAATGGAGCAAAAAAGCAGGG + Intronic
1072853915 10:98926397-98926419 GGTAATGGTACAATACAGCTAGG + Intronic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073667313 10:105548057-105548079 GAGAATGGACTAATACAGAGAGG + Intergenic
1073732843 10:106310987-106311009 CAAAATGGACTAAGACACCTAGG + Intergenic
1073785665 10:106886351-106886373 AAAAATGGACTAATACACCATGG + Intronic
1073833269 10:107411308-107411330 GAAAATGGACTAACACAGACTGG + Intergenic
1074258843 10:111831825-111831847 GAGAATGGACTAATACATCTGGG - Intergenic
1074287354 10:112110634-112110656 GGAAATGGACTAATACACCCAGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074440275 10:113471818-113471840 CAAAATGGACTAACACAGCAGGG - Intergenic
1074689007 10:115987145-115987167 GAAAATGGAGTAATACAAGTGGG - Intergenic
1075081945 10:119390194-119390216 GAAAACGGACTAATACAGACGGG - Intronic
1075152257 10:119944434-119944456 GAAAATGGACTAATACAGTCAGG + Exonic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077667877 11:4131015-4131037 GAGAATCGACTAATACAACTGGG - Intronic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078477408 11:11642959-11642981 GAAAATGGACTTAGACAGCAAGG - Intergenic
1078518672 11:12046590-12046612 GAAAATGGAGTAATACAGTGGGG + Intergenic
1078959362 11:16247404-16247426 GAGAATGGACTAATACAGAAAGG - Intronic
1079554243 11:21739792-21739814 GAAAATAGACTAATACAGTGGGG - Intergenic
1079570950 11:21942641-21942663 GAGAATGGACTAATACATCCAGG + Intergenic
1079992322 11:27259356-27259378 GAGAATGGACTAATACAACCAGG - Intergenic
1080194702 11:29595485-29595507 GAGAATGGACTAATACACCAAGG + Intergenic
1080227735 11:29978543-29978565 GAAAATGGACTAATACAGTTGGG + Intergenic
1080290385 11:30664513-30664535 GAGAATGGACTAATACATTTGGG - Intergenic
1080367977 11:31599535-31599557 GAGAATGAACTAATACAGCCAGG - Intronic
1080715831 11:34798734-34798756 GAGAATGGACTAATACAGCTAGG + Intergenic
1080824809 11:35838938-35838960 GAAAATGGACTAATACAGATGGG - Intergenic
1080958683 11:37131445-37131467 GAAAATGGACTACTACAGGATGG + Intergenic
1082043626 11:47707288-47707310 GAAAATGGACTAACACAGCTGGG - Intronic
1084720895 11:70904994-70905016 GAAAATGGACTAATACAGTGGGG + Intronic
1085617868 11:78015348-78015370 GAAAACAGACTAATACAGATGGG + Intergenic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1086419147 11:86620909-86620931 GAAAATGCACCAAGACAAGTGGG - Intronic
1087664547 11:101028697-101028719 GAAACTGGCCCAAATCAGCTAGG + Intergenic
1087898160 11:103610548-103610570 GAGAATGGACTAATACAGTAGGG + Intergenic
1087917053 11:103823220-103823242 GAGAATGGAGTAATACAGCAGGG - Intergenic
1088706186 11:112466576-112466598 GAAAATGGACTAATACAATCAGG - Intergenic
1088733344 11:112703550-112703572 GAATATGGACTAATACACCTGGG + Intergenic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1089732607 11:120528535-120528557 GAAAACAGACTAATACAGATGGG - Intronic
1089978016 11:122749522-122749544 GAGAATGGAACAATACAGAGAGG - Intronic
1090924810 11:131240085-131240107 GAAAATGGACTAATAGAAATGGG + Intergenic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1093185587 12:16015601-16015623 GAAAACGGACTAATACAATTTGG + Intronic
1093315759 12:17647671-17647693 GAAAATGGACTAATACACTGGGG + Intergenic
1093570872 12:20664243-20664265 GAGAATGGACTAATACACCAGGG + Intronic
1094025240 12:25955070-25955092 GCAAATGGACCAGTACAGATGGG - Intergenic
1094057902 12:26285313-26285335 GAAAATGGATCTTTGCAGCTAGG + Intronic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094394070 12:29986100-29986122 CAGAATGGACCAAGACAGCAGGG - Intergenic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095557188 12:43522035-43522057 GAGAACGAACTAATACAGCTGGG - Intronic
1095611784 12:44137502-44137524 GAAAATGGACTAAGACAACATGG - Intronic
1097139439 12:56887548-56887570 GAGAATGGACTAATACAGACTGG + Intergenic
1097256036 12:57675199-57675221 GAAAATTGACAAATACAGGGAGG + Intergenic
1097894128 12:64807373-64807395 GAGAATGGACTAATACAGAGAGG + Intronic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098144799 12:67487506-67487528 GAGAATGGACTAATACAGCTGGG - Intergenic
1098256182 12:68618056-68618078 GAACAAGAACTAATACAGCTGGG - Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098536346 12:71597632-71597654 TAAAATGAACCAATACACCTGGG + Intergenic
1099039404 12:77632279-77632301 GAAAACGGGCTAATACAGATTGG - Intergenic
1099443353 12:82724663-82724685 GAAAACGGACTAATACAACTTGG + Intronic
1099621025 12:85003040-85003062 GAAAATCAACCAATATAGATGGG + Intergenic
1099654909 12:85478152-85478174 GAAAACGAACTAATACAACTTGG - Intergenic
1099794876 12:87387356-87387378 AAAAATTGACAAATAGAGCTAGG + Intergenic
1100250086 12:92812033-92812055 AAAAATGGACCAATAAAGCCAGG + Intronic
1100352810 12:93800743-93800765 GAGAATGGACTAATACAGTGAGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101231172 12:102742995-102743017 GAAAATGGACTAATACAAGCTGG + Intergenic
1101260824 12:103027866-103027888 GAGAACGGACTAATACAGCAAGG - Intergenic
1101305350 12:103522389-103522411 GTGAATGGACTAATACAGCTGGG + Intergenic
1102442317 12:112972660-112972682 GTAAATAGACCAATGCAGTTAGG + Exonic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102716536 12:114978291-114978313 GAAAATGGACTAATACACTGAGG - Intergenic
1102937615 12:116911034-116911056 GAATATGGACGACTACAGCCTGG + Exonic
1103015856 12:117494030-117494052 GAAAATGGACTAATACGGGCAGG + Intronic
1104159546 12:126165119-126165141 GAAAATGGACTAATACCGTGGGG + Intergenic
1104268276 12:127258882-127258904 GGGAATGGACTAATACAACTGGG - Intergenic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1104799134 12:131541509-131541531 GAAAATGGACTAATACAAGGAGG - Intergenic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1105977272 13:25482952-25482974 GAAAACGGACTAATACAGAAGGG + Intronic
1105991431 13:25626186-25626208 GAAAATTGACCAAGACAGGAAGG - Intronic
1106382408 13:29252961-29252983 GAAAATGGACTAATAGAAGTAGG + Intronic
1106499469 13:30313571-30313593 GAAAAAGGAGCAGTACAGCTGGG + Intergenic
1106910353 13:34456543-34456565 GAAAATGAACTAATACAATTAGG + Intergenic
1106915955 13:34514761-34514783 GAAAACAGACTAATACAGTTGGG - Intergenic
1107120335 13:36789005-36789027 GAAAATGGACTAAGACACCCAGG - Intergenic
1107183041 13:37484615-37484637 GAAAACGGACTCATACAGATGGG - Intergenic
1107586312 13:41851743-41851765 GAAAATGGATTAATACAGACGGG + Intronic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108441386 13:50456625-50456647 GAGAATGGACCAACACAGCTTGG - Intronic
1108754668 13:53485408-53485430 GAGAATGGAATAATACAGATAGG + Intergenic
1109107787 13:58277155-58277177 GAAAATGGACTAATACAATGAGG - Intergenic
1109109201 13:58293868-58293890 GAGAATCGACTAATACAGATGGG + Intergenic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109447049 13:62454582-62454604 GAAAATGGCCCAATAATGGTGGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1109880253 13:68463954-68463976 GAGAATGAACTAATACACCTAGG + Intergenic
1110187437 13:72691901-72691923 GAGAATGGACTAATAGAGTTAGG - Intergenic
1110361556 13:74631059-74631081 AAAAATGGACTAATACACCCTGG + Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110439794 13:75515398-75515420 GAAAATGGACTAACACAGGAGGG - Intergenic
1110449391 13:75624523-75624545 GAAAACAGACTAATACAGGTGGG - Intronic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1111278361 13:85983702-85983724 ATAAATGGAACAATACAGCCTGG - Intergenic
1111314085 13:86529066-86529088 GAAAATGGACTAATACACTGTGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111655763 13:91150229-91150251 GAAAATTGACTAATACATCAAGG + Intergenic
1111801550 13:92987090-92987112 GAAAATGGACTAATAGACATAGG + Intergenic
1111811821 13:93100691-93100713 GAAAATGGACCAAGACAGATGGG + Intergenic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112750875 13:102582270-102582292 GAAAATGAACTAATACACATAGG - Intergenic
1113152594 13:107281641-107281663 GAAAATGGACTAATACAGTCAGG - Intronic
1113693504 13:112328535-112328557 GAAAACAGACTAATACACCTTGG - Intergenic
1113915436 13:113868260-113868282 GAAAATTGACTAATACACTTGGG + Intergenic
1114338131 14:21714289-21714311 GAGAATGGAGTAATACACCTGGG - Intergenic
1114955045 14:27806529-27806551 GAAAACAGACTAATACAGCTAGG + Intergenic
1115430944 14:33317810-33317832 GAGAATGGACTAATACACCAAGG + Intronic
1116184395 14:41578104-41578126 GAAAATGGATTAATATATCTGGG + Intergenic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117483931 14:56174816-56174838 GAGAATGGACTAATACAACCAGG + Intronic
1117652780 14:57924213-57924235 GAGAATGAACCAATACAGCTGGG + Intronic
1117958783 14:61143329-61143351 GAAAATGGACTAATACAGATGGG - Intergenic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1119851542 14:77870009-77870031 GAGAATGGACCAACACAGATGGG + Intronic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120394075 14:83945176-83945198 GAAAACGGACTAATTCAGGTAGG - Intergenic
1120575483 14:86175661-86175683 GAAAATGGACTAATACAGGGAGG + Intergenic
1120692182 14:87605175-87605197 GAAGATGGACTAATACACATGGG - Intergenic
1120771042 14:88380657-88380679 GAAAATGGAACTTTAGAGCTTGG - Intergenic
1120863785 14:89278065-89278087 GAAAATGGACTAATACAGTGGGG - Intronic
1121036497 14:90708495-90708517 GTAAATGGAACAATAAAGCCTGG + Intronic
1121207348 14:92180456-92180478 GAAAATGGACTAATACAGGTGGG + Intergenic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1121479944 14:94258843-94258865 GAAAATGGACCAACACAATAAGG - Intronic
1121483664 14:94297309-94297331 GAAAATGGACTAATACACTGTGG - Intergenic
1122008034 14:98721952-98721974 GAGAATGGACTAATACAGATGGG + Intergenic
1122361979 14:101172863-101172885 GAAAATGGACTAATACAGATTGG - Intergenic
1122386569 14:101352314-101352336 GAAAATGTACCAAGAAAGCATGG + Intergenic
1122478804 14:102032188-102032210 GAGAATGAACCAAAACAGCCAGG - Intronic
1122837947 14:104440002-104440024 GAAAATGGAACAACAAAGCCTGG - Intergenic
1122850132 14:104523529-104523551 AAGAATGGCCTAATACAGCTGGG - Intronic
1123013724 14:105363094-105363116 GAAAATGGAACAACAAAGCCTGG - Intronic
1123124447 14:105936254-105936276 GAAAATGGACTAATACACTATGG - Intergenic
1124194316 15:27607448-27607470 AATAATGGCCCAATACAGCTAGG + Intergenic
1124436988 15:29658423-29658445 GATAATTGACGAATACAACTGGG + Intergenic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1125590445 15:40851444-40851466 GAAAATGGCAGAACACAGCTGGG - Intronic
1125952360 15:43763546-43763568 TAAAAATGACCAATTCAGCTGGG - Intronic
1126272922 15:46843820-46843842 GAAAATGGACTAATATATATTGG - Intergenic
1126383660 15:48072806-48072828 GAAAATGGACTAATACAGGCTGG - Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127008529 15:54596978-54597000 CAAAATGGACTAACACAACTGGG + Intronic
1127129095 15:55843239-55843261 GAAAACGGACTAAAACAGCCAGG + Intronic
1127969597 15:63947942-63947964 GAGAATGGACTAATACAAGTGGG - Intronic
1128470895 15:67951602-67951624 GAAAATGGACTAATAGAAATGGG + Intergenic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130448916 15:84031099-84031121 GAAAATGGACTAATACAGAGGGG + Intronic
1130675234 15:85946561-85946583 GAAAATGGGCCAATATAACCTGG - Intergenic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1132811387 16:1799752-1799774 GAGAATGGACTAATGCAGATGGG + Intronic
1132890544 16:2202196-2202218 GAAAATGGACTAATACTCCATGG - Intergenic
1133693246 16:8236371-8236393 GAAAATGGACTAGTATAGTTTGG - Intergenic
1133791139 16:9010056-9010078 AAAAATACACGAATACAGCTTGG - Intergenic
1134600676 16:15531263-15531285 GAGAATGGACTAATACAGTTGGG + Intronic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134804161 16:17110617-17110639 GAGAACAGACAAATACAGCTAGG + Intronic
1134840110 16:17394957-17394979 GAAAATGGACTAATACAGGGGGG - Intronic
1135645456 16:24157618-24157640 GAGAATGGACTAATACACATGGG + Intronic
1135645497 16:24157937-24157959 GAGAATGGACTAATACACATGGG + Intronic
1135723367 16:24835601-24835623 GCAAATGGACTAATACAGATGGG - Intergenic
1135808246 16:25564076-25564098 GAAAATGGAATAATACAGCGTGG + Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1137230894 16:46566179-46566201 AAAAATGGAAAAATACAGTTGGG + Intergenic
1137356978 16:47776393-47776415 GAAAATGTACCTATACAGAATGG + Intergenic
1137810812 16:51350852-51350874 GAGAACGGACCAATACAGGTTGG - Intergenic
1138406631 16:56800391-56800413 GTAAATGGATTAATAAAGCTTGG - Intronic
1138778160 16:59750543-59750565 GAAAATGGACAAATACACTCTGG - Intronic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1138956532 16:61977583-61977605 TAAAATTGAACAATACACCTCGG + Intronic
1139032379 16:62900592-62900614 GAGAATGGACTAATACACCATGG + Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1140024351 16:71271028-71271050 AAAAATTAGCCAATACAGCTGGG + Intergenic
1140665326 16:77222219-77222241 GAACCTGGACTAATACAGCAAGG - Intergenic
1140772234 16:78215629-78215651 AAAAACGGACTAATACAGGTTGG + Intronic
1140824370 16:78692138-78692160 GAAAACGGACTAATACAGTGAGG + Intronic
1140998117 16:80280792-80280814 GAGAACTGACTAATACAGCTGGG - Intergenic
1141045076 16:80708524-80708546 GAGAATGAACGAATACATCTTGG + Intronic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1141573002 16:84945805-84945827 GACAACGGACTAATACAGTTAGG + Intergenic
1141923027 16:87148726-87148748 GAGAATGGACTCATACAGTTGGG - Intronic
1142353897 16:89592489-89592511 GAGATTGCACCACTACAGCTTGG - Intronic
1142471814 17:168937-168959 GAAAATGGACTAATACAGGGAGG + Intronic
1142503328 17:346295-346317 GAAAACGGACTAACACAACTGGG - Intronic
1143755448 17:9064004-9064026 AAAAAGGGACCATTACAGTTAGG - Intronic
1144608901 17:16690950-16690972 GAAAATGGATAAACACAGTTGGG - Intronic
1144810523 17:17995934-17995956 GAAAACAGACTAATACAGATAGG - Intronic
1144903919 17:18624870-18624892 GAAAATGGATAAACACAGTTGGG + Intergenic
1145128665 17:20321872-20321894 GAAAATGGATAAACACAGTTGGG - Intergenic
1145195960 17:20895443-20895465 GAAAATGGATAAACACAGTTGGG + Intronic
1146464479 17:33075381-33075403 AGAAATGGACTAATACAGGTGGG + Intronic
1148285064 17:46381981-46382003 AAAAATAGAACATTACAGCTGGG + Intergenic
1148307227 17:46599578-46599600 AAAAATAGAACATTACAGCTGGG + Intronic
1148468371 17:47878263-47878285 GAAAATGGAGCAATTAAGATGGG - Intergenic
1148529203 17:48373058-48373080 GAAAATGGACTAATACAACCTGG - Intronic
1149025805 17:52026485-52026507 GAGAACAGACCAATACAGTTGGG - Intronic
1149143303 17:53459252-53459274 GAAAATGAACTAATACAGATGGG + Intergenic
1149260879 17:54878175-54878197 AAAAATGGACTAATACAGTTTGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1150461735 17:65359342-65359364 GACAATGGACGAATAAAACTGGG - Intergenic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1150856199 17:68755416-68755438 GAAAACGGACTAATACAGAGAGG - Intergenic
1150971363 17:70031925-70031947 GAAAACGGCCTAATACATCTGGG - Intergenic
1151039272 17:70839879-70839901 GAAAACAGACTAATACAGATGGG - Intergenic
1151065096 17:71139673-71139695 TAAAATGGACCAAGACTCCTTGG + Intergenic
1151097259 17:71512465-71512487 AAAAATTGACCAATATACCTAGG + Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151350667 17:73530158-73530180 GAAAATGGACTAATGCAGGAGGG - Intronic
1151874843 17:76861860-76861882 GAAAACAGACTAATACAGCCAGG - Intergenic
1152010070 17:77707560-77707582 GAAAACGGACTAATACACTTTGG + Intergenic
1152160707 17:78666906-78666928 GAAAAGGAATGAATACAGCTGGG - Intergenic
1152348202 17:79767792-79767814 GAAAATGGACTAATATGGCTGGG - Intergenic
1153064139 18:1025850-1025872 GAAAATGGCAGAATTCAGCTTGG - Intergenic
1153362749 18:4216004-4216026 GAGAATGGACTAATACATTTAGG - Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154938539 18:21087437-21087459 TAAAATGCAACAATACAGGTAGG + Intronic
1155293995 18:24369115-24369137 GAAAATGGACTAATACGATTTGG + Intronic
1155746719 18:29363034-29363056 GAAAATGGATGAATACAGTGGGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156117303 18:33801711-33801733 GAGAATGGGCTAATACAACTGGG - Intergenic
1156568071 18:38218945-38218967 GAGAATGGACTAATACACCAGGG + Intergenic
1156644932 18:39149507-39149529 GAGAATGGACTAATACATATGGG - Intergenic
1156649359 18:39206132-39206154 GAAAATGTGACAATATAGCTGGG + Intergenic
1156687304 18:39665972-39665994 GAGAATGGACTAATACAGAGAGG - Intergenic
1156769295 18:40699434-40699456 GAAAATGGACCAATACAACTGGG + Intergenic
1156836515 18:41561639-41561661 AAAAATAGACTAATACAGATGGG + Intergenic
1156969147 18:43133890-43133912 GAAAATGAATGAATACAGTTAGG + Intergenic
1157234439 18:45950605-45950627 GAAAAAGGACTAATACATTTGGG + Intronic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1157718533 18:49906073-49906095 GAAAAGAGACCAATACAGCCTGG - Intronic
1157875597 18:51270486-51270508 GAAAATGAACTAATACGGCCGGG - Intergenic
1158035612 18:53026011-53026033 GAAAATGTTCCAATTCAGCTTGG + Intronic
1158130101 18:54142937-54142959 GAAAATAGACTAATACAACTGGG + Intergenic
1158855570 18:61540341-61540363 GAAAATGGACTAATACATGAAGG - Intronic
1159077581 18:63699347-63699369 GAAAATGAACTAATACAATTAGG - Intronic
1159131292 18:64282467-64282489 GAAAATGGATTAATACAGGTGGG + Intergenic
1159160028 18:64631915-64631937 CAGAATGGCCTAATACAGCTAGG + Intergenic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1159799538 18:72880299-72880321 GAAAATGGACTTATACAGTTGGG + Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1165259447 19:34599331-34599353 GAAAAGAGACTAATACAGATGGG - Intronic
1165373727 19:35426747-35426769 GAAAATGGACCACCACACATAGG - Intergenic
1166263074 19:41656656-41656678 GAAAATGGACTAATACAGATAGG - Intronic
1166314197 19:41979600-41979622 AAAAATGGAAGCATACAGCTGGG - Intronic
1166968755 19:46547877-46547899 GAAAATGGTCTAATACACCAGGG + Intronic
1167403645 19:49289672-49289694 GAAAATGAACTAATACAGACTGG + Exonic
924963427 2:55465-55487 GAAAATGGACCACCACATATAGG + Intergenic
925205562 2:2003036-2003058 GAGAATGGACTAATATACCTTGG + Intronic
925359996 2:3271671-3271693 GTAAATGGAACAATAAAGCCTGG - Intronic
925437116 2:3848040-3848062 GAGAACAGACTAATACAGCTGGG + Intergenic
925440877 2:3884039-3884061 GAAAATGGACTAATATAACCTGG - Intergenic
925475568 2:4210719-4210741 GAAAACGGACTAATACACCTGGG - Intergenic
925857595 2:8145354-8145376 AAAAATGGACTAATACACCAAGG - Intergenic
925907837 2:8549953-8549975 CAAAATGGACTAACACAGTTGGG + Intergenic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927225169 2:20757544-20757566 TAAAATTGACCATCACAGCTTGG - Intronic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928396502 2:30946670-30946692 TAGAATGGACTGATACAGCTGGG + Intronic
928749682 2:34457355-34457377 GAGAATGGACTAATACAGAGAGG - Intergenic
928823095 2:35387021-35387043 GAAAATGGACTAATACAATGAGG - Intergenic
928848955 2:35718313-35718335 GAGAATGAACTAATACAGCATGG + Intergenic
929010455 2:37437890-37437912 GAAAATTGACTGATACAGATGGG - Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929714978 2:44301089-44301111 GACCATGGACCAATACAGCACGG + Exonic
929759067 2:44791104-44791126 GAAAATGGACTAATACAATCAGG - Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930239305 2:48919440-48919462 GCAACTGGCCCAAAACAGCTAGG - Intergenic
930309798 2:49726276-49726298 GAAAATGGCCTAATACAGGTGGG - Intergenic
930427681 2:51233143-51233165 GATAATGGACTAATACAGATAGG - Intergenic
930438623 2:51378241-51378263 GAGAATGGACTAATACAGGAAGG + Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
930990003 2:57641943-57641965 GAAAATTGACTAGTAGAGCTAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
933296048 2:80492405-80492427 GAGAATGGACTCATACAGATGGG + Intronic
933943834 2:87267356-87267378 GAAAATGGACTAACACAACAGGG + Intergenic
934482301 2:94662992-94663014 GAAAACAGACCAATACAGCTAGG - Intergenic
934966349 2:98727240-98727262 GAAAATGCAGCAATCCAGCCAGG + Intronic
936336386 2:111594223-111594245 GAAAATGGACTAACACAACAGGG - Intergenic
936658245 2:114513225-114513247 GAAACTGGACCTTTACAGCTGGG + Intronic
936731229 2:115383479-115383501 GAAAATGGACTAATAGAAGTGGG + Intronic
936855500 2:116953071-116953093 GAGAACGGACTAATACAGTTTGG - Intergenic
936936997 2:117848255-117848277 GAAAATGGACTAAAACAGGGAGG + Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937620745 2:123982155-123982177 GGATATGGACCAAAACTGCTTGG + Intergenic
937777943 2:125803536-125803558 GAGAATGGACTAATACAGATGGG - Intergenic
937943188 2:127305815-127305837 TTAAATGGAACAAGACAGCTGGG - Exonic
938216211 2:129518912-129518934 GAGAATGGACCAATACACCAGGG - Intergenic
938336584 2:130505592-130505614 AAAAATGGATGAACACAGCTTGG + Intronic
938353234 2:130615070-130615092 AAAAATGGATGAACACAGCTTGG - Intronic
938411283 2:131066842-131066864 GAGAATGAACTAATACAACTGGG - Intronic
938982032 2:136536226-136536248 GAAAACAGACTAATACAGGTGGG - Intergenic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
940137785 2:150458721-150458743 CAAAAAAGACCACTACAGCTAGG - Intergenic
941057484 2:160805801-160805823 GAAAATGGACTAATACAGATAGG - Intergenic
941503297 2:166308625-166308647 AAAAATGGACTAATACGGCCGGG + Intronic
942557410 2:177186119-177186141 GAAAACAGACTAATACAGTTTGG - Intergenic
942822314 2:180129025-180129047 GCAAATGGAACAATAAAGCCTGG - Intergenic
942845346 2:180417684-180417706 GAAAATGGACTAATACAGTGAGG + Intergenic
943491473 2:188560071-188560093 GAAAGTGGACTAATACAGTGAGG + Intronic
943636129 2:190308754-190308776 GAAAATGGACTAACACAGTTAGG + Intronic
943788318 2:191902544-191902566 GAAAACGGACTAATACAAGTAGG + Intergenic
943880849 2:193141992-193142014 GAAAATGGACTAATACTCCAAGG + Intergenic
943943269 2:194026083-194026105 GAGAACAGACCAATACACCTAGG - Intergenic
943978023 2:194508926-194508948 GAAAATAGATTAATACAGTTGGG - Intergenic
944277320 2:197853757-197853779 TAAAATGGGGCAATATAGCTTGG - Intronic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
944827826 2:203503276-203503298 GAAAACAGACTAATACAGATGGG - Intronic
944855407 2:203762426-203762448 GAGAATAGACTAATACAGTTGGG + Intergenic
945157873 2:206858612-206858634 GAAAACAGACTAATACACCTTGG + Intergenic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945589293 2:211709764-211709786 GAAATTGGAGCAACACAACTAGG - Intronic
945766088 2:213979363-213979385 GGAAAAGGAACAATACAGGTGGG - Intronic
945792339 2:214320466-214320488 GAAAATGGACTAATACAACCAGG - Intronic
945892992 2:215450217-215450239 GACAATGGACTAATACAATTGGG - Intergenic
946023152 2:216655601-216655623 GAAAATGGACTAATACAGTCAGG + Intronic
946146425 2:217734618-217734640 GAAAAAGGATTAATACAGTTGGG - Intronic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946407721 2:219500847-219500869 GGAAATGGATTAATGCAGCTTGG + Intronic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
947341457 2:229143946-229143968 GAAAATGGACTAATACAGGGGGG + Intronic
947381858 2:229552752-229552774 GAAAACTGACTAATACAGGTGGG + Intronic
947527656 2:230889051-230889073 GAACATGGACTAATACAGAGAGG - Intergenic
947903955 2:233745968-233745990 GAAATGGGACCATGACAGCTGGG + Intronic
947905361 2:233757323-233757345 GAAATGGGACCATGACAGCTGGG + Intronic
948240721 2:236431207-236431229 GAGAATGGACTAATACACCTGGG - Intronic
948299437 2:236890965-236890987 GAGAACGGACTAATACAGATGGG + Intergenic
948310704 2:236983814-236983836 GAAAATGGACTAATACAACCAGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
948810991 2:240478280-240478302 GAGAATGGACTAATACAGTGCGG + Intergenic
949062774 2:241970693-241970715 GAAAATGGACCACCACATATAGG - Intergenic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1169395094 20:5221982-5222004 GAAAATGGACTAAGGCACCTGGG + Intergenic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1169726275 20:8736501-8736523 GAAAATGGACAAACACAGGTTGG - Intronic
1170048020 20:12108350-12108372 GAGAATGGACTAATACGACTGGG - Intergenic
1170627836 20:18043002-18043024 CAAAATGGACTAAGACAGCATGG + Intronic
1170797126 20:19557800-19557822 GAAAGTGGACAAGTTCAGCTTGG - Intronic
1171037340 20:21726204-21726226 GAAAATGGACCAAGACAGGAAGG - Intergenic
1171091901 20:22293267-22293289 GAAAATGGAATAATACAGAAGGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1172006006 20:31819590-31819612 GAAAATGGAGCAGTTGAGCTGGG + Exonic
1172364472 20:34338405-34338427 GAAAATGAAGCAAGACAGCAAGG + Intergenic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1173264042 20:41461678-41461700 GAAAATGAACCAATACATCCTGG + Intronic
1173317958 20:41961845-41961867 GAGAACAGACTAATACAGCTAGG + Intergenic
1173593699 20:44245323-44245345 GAGAATGGTCTAACACAGCTGGG - Intergenic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1174919557 20:54687050-54687072 GAAAATGGACTAAGACAGTCTGG + Intergenic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1177061995 21:16387450-16387472 GAAAATGTACCAATAATGCCAGG - Intergenic
1177822396 21:26045821-26045843 GCAAATGAACTAATACAGCTCGG - Intronic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1178028567 21:28496820-28496842 GAGAACAGACTAATACAGCTGGG - Intergenic
1178099425 21:29252140-29252162 GAAAATGGACTAATATACTTGGG - Intronic
1178221071 21:30660885-30660907 GAAAATGGACTAATACATGCAGG - Intergenic
1178406406 21:32326857-32326879 AAGAATGGACCAATAGAGATGGG + Intronic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1178683681 21:34694748-34694770 GAGAATGGACTAATACACCTTGG + Intronic
1178740306 21:35193893-35193915 GAAAATGGACTAATACAGATGGG - Intronic
1179322180 21:40302505-40302527 AAAAATGGACTAATACAGAGCGG + Intronic
1179337448 21:40471009-40471031 GAAAATGGAATATGACAGCTAGG - Intronic
1179439697 21:41384281-41384303 GAGAACGGACTAATACAGGTGGG + Intronic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1183002706 22:34874950-34874972 GAATGGGAACCAATACAGCTGGG + Intergenic
1183536794 22:38406644-38406666 GAAAAAAGAGAAATACAGCTGGG - Intergenic
1184386408 22:44178178-44178200 GGAAATGGACTAATACACATAGG + Intronic
949103942 3:180683-180705 GAAAATGGTAGAATATAGCTAGG + Intergenic
949363156 3:3253086-3253108 GAAAACGGACTAATACAGTGTGG - Intergenic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
950146184 3:10651590-10651612 GAAAATGGAGTAACACAGATGGG + Intronic
951269863 3:20610861-20610883 GAAAATGTACCTATACACCATGG + Intergenic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
951953178 3:28224443-28224465 GAAAATGGACTAATACAAGTGGG - Intergenic
952080898 3:29756314-29756336 GAGGATGGACTAATACACCTGGG - Intronic
953073565 3:39547303-39547325 GAGAATGGACTAATACAGGGAGG + Intergenic
953456607 3:43047308-43047330 GAGAATGGACTAATACAGGTGGG + Intronic
953717323 3:45326650-45326672 TAAAATGTAGCAATTCAGCTTGG + Intergenic
954591735 3:51788997-51789019 GAAAATGAGCTAATACAGGTAGG + Intergenic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
955471728 3:59293826-59293848 GAAAATAGACTAATACACCAAGG - Intergenic
955820425 3:62890667-62890689 GAAAATGGACTAATACAATGGGG - Intergenic
955902998 3:63777195-63777217 CAAAATGGACTAACACAGATAGG + Intergenic
955970841 3:64436773-64436795 AAAAATGGACTAATACAGTGGGG + Intronic
956268345 3:67423393-67423415 GAGAATGGACTAATACACCTAGG + Intronic
956292641 3:67677546-67677568 GAACCTAGACTAATACAGCTGGG + Intergenic
956503430 3:69911307-69911329 GAAAACGGACCAGTATAGATGGG + Intronic
956855993 3:73275378-73275400 GAAAATGGACTAATACAATGTGG - Intergenic
957020255 3:75118533-75118555 GAAAATGGACTAATCCAGTGGGG - Intergenic
957166167 3:76676469-76676491 GAAAACGGACTAATACAACAAGG + Intronic
957434342 3:80154275-80154297 AAGAATGGACTAATACATCTGGG + Intergenic
957555305 3:81759169-81759191 GAAAACGGACTAATACAGAAGGG + Intronic
957831769 3:85530680-85530702 GAGAATGGATTAATACAGATAGG + Intronic
958638364 3:96775140-96775162 GAAAATGGACTAATACAGGTGGG - Intergenic
958710514 3:97711359-97711381 GAAAATGGACTAATACAGTCAGG + Intronic
958799487 3:98738602-98738624 GAGAATGAACTAATACAGATGGG + Intronic
959214661 3:103436580-103436602 GAAAACGGACTAATACAGAGAGG - Intergenic
960359077 3:116688943-116688965 GAGAATGGACTAATACACTTAGG - Intronic
960428367 3:117537037-117537059 GAAAATGGACCGATACAAGAAGG + Intergenic
960462360 3:117952001-117952023 GAGAATGAACTAATACAGATGGG + Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
960837493 3:121921829-121921851 GAAAGAGGACCAATAAAACTTGG + Intronic
961064305 3:123861597-123861619 GTAAATGGCCAAAGACAGCTTGG - Intronic
961342983 3:126242144-126242166 GAAAATGGACTAATAAATATTGG + Intergenic
962157832 3:132967547-132967569 GAAAATGGATTAATACAGTGAGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962814773 3:138988071-138988093 GAAAGAGGACCAAGACAGCGGGG + Intergenic
963339606 3:144019089-144019111 GAGAATGGACTAATATAGCTGGG - Intronic
963347988 3:144118855-144118877 GAAAATGGTCTAATACAAATAGG + Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963478739 3:145840526-145840548 GAAAATCGACTATTACAGCTAGG - Intergenic
963867639 3:150379525-150379547 GAAAATGGACTACTACAGGAGGG + Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
963955437 3:151248510-151248532 TAAAGTGGACCAGTACAGCTGGG - Intronic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964654715 3:159053151-159053173 GAAAACGAACTAATACACCTGGG + Intronic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
965864507 3:173189314-173189336 GAAAATTGACCAAGATAGATGGG + Intergenic
966314651 3:178632308-178632330 GAGAATGGACTAATACACCATGG - Intronic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969135603 4:5026301-5026323 GAGATTGGACTAATACAACTGGG - Intergenic
969144852 4:5113723-5113745 GAAAATAGACTAGTACAGGTAGG - Intronic
969504760 4:7578356-7578378 CAAAATGGACTAAGACAGGTGGG + Intronic
969948938 4:10813753-10813775 GAAAATGGACTAAAACAGGTAGG - Intergenic
970094307 4:12445249-12445271 GAAAATGGACTAATAAGGCCGGG - Intergenic
970132565 4:12887275-12887297 GAGAATGGACCAATACGAATGGG + Intergenic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970313532 4:14807782-14807804 GAAAAGGGACTAATACACCATGG - Intergenic
970718641 4:18959263-18959285 GAAAATGGATGAATACAGAAGGG - Intergenic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971454805 4:26834271-26834293 GAGAATGGACTAATACAGGTTGG + Intergenic
971459422 4:26878648-26878670 GAAAATGAACTAATACAGATGGG - Intronic
971480734 4:27112873-27112895 GGAAATGGACTGATACAGGTGGG - Intergenic
971753469 4:30679434-30679456 GAAAGTGGACTAATTCAGATAGG + Intergenic
971901855 4:32670251-32670273 GAAAATGGACCGATATACCTAGG + Intergenic
971958310 4:33452423-33452445 GAAAAAGGACTAATACAGTGGGG + Intergenic
972220451 4:36949149-36949171 GAGAATGGACTAATACAGATGGG - Intergenic
972296630 4:37745508-37745530 GAGAATAGACTAATACAGCAGGG - Intergenic
972664391 4:41150023-41150045 GAAAATGGACTAATACACTGGGG + Intronic
972744793 4:41922486-41922508 GAGAATGGACTAATATAGCAGGG + Intergenic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
973334971 4:48946982-48947004 GAAAATGGACTAATACAGTTGGG - Intergenic
973669945 4:53206868-53206890 GAAAATGGACTAAGACAACCAGG - Intronic
974511294 4:62845358-62845380 GAAAATGGACTAATACAGATTGG - Intergenic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975600665 4:76096343-76096365 GAAAGTGGACCAAATCACCTGGG + Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
975919787 4:79371406-79371428 GAAAATGAACTAATACAGTTGGG - Intergenic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
977013949 4:91669451-91669473 GAAAATGGACTAATACATGAAGG - Intergenic
977880915 4:102204676-102204698 GAAAATGGTCTAATACAGTCTGG - Intergenic
978032857 4:103957350-103957372 GAAAATGGACTAACACAGAAGGG - Intergenic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
979009128 4:115344413-115344435 AAAATTAGACCAATAGAGCTAGG - Intergenic
979203284 4:118005021-118005043 GAGAATGGACTAATACACCCTGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979856040 4:125636131-125636153 GAAAACTGACTAATACAGTTGGG - Intergenic
980199161 4:129632718-129632740 GAAAATGGACTAATATAGTCAGG - Intergenic
980553093 4:134365893-134365915 GAAAATGGCCTAATACAACCAGG + Intergenic
980701136 4:136432512-136432534 GAAAATAGACCCATTCAGCAAGG + Intergenic
980746242 4:137020399-137020421 GAAAATTGACCAGTACACCAGGG + Intergenic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981695398 4:147554025-147554047 GAAAATGGACTAATACAATTGGG + Intergenic
981929077 4:150170608-150170630 AAAAATAGAACATTACAGCTGGG + Intronic
981997779 4:150993530-150993552 GAAAATGGACTAATACAATGAGG - Intronic
982301364 4:153882192-153882214 GAGAATGGACCAATACATTCTGG + Intergenic
982332536 4:154197065-154197087 AAAAATGGACTAATACAGAAAGG + Intergenic
982797253 4:159661257-159661279 GAAAATGGACTAATACAGGCAGG - Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
983766507 4:171490539-171490561 GAGAATGGACTAATACAGTGTGG + Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
983811303 4:172065662-172065684 GAGAATGGACTAACACAGTTAGG - Intronic
984162029 4:176264644-176264666 GAAAGTGGACCCTTAGAGCTTGG - Intronic
984553155 4:181184407-181184429 GAAAACGGACCAGTACACCCAGG - Intergenic
984718937 4:182952478-182952500 GAGAATGCACTAATACAACTAGG + Intergenic
985076952 4:186225171-186225193 GAAACTGGACTAATACATCTGGG + Intronic
985340203 4:188943049-188943071 GAGAATGGACTAATACAGAAAGG + Intergenic
986023906 5:3831770-3831792 GAGAATGGACTAATACAGTAAGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
986173006 5:5328775-5328797 GAAAACGGACGAATACACCCTGG - Intergenic
986221974 5:5776267-5776289 GGAAATGGACTAATACAGCCTGG + Intergenic
986406188 5:7427264-7427286 GAGAATGAACTAATACAGGTGGG - Intronic
986503584 5:8427256-8427278 GAAAATGGATGAATACACCCAGG - Intergenic
986736182 5:10669038-10669060 GAAAATGGAGCAGTAGAACTGGG + Intergenic
986751272 5:10790061-10790083 GAACCCGGACTAATACAGCTTGG - Intergenic
986798265 5:11233146-11233168 GAGAATGGACTAATACAGAGGGG + Intronic
987261907 5:16212888-16212910 GAAAATGGACTAATACAGAGTGG - Intergenic
987441650 5:17964414-17964436 GAAAACAGACTAATACAGTTTGG - Intergenic
987909261 5:24121298-24121320 GAAAATGGACGAATACACAGAGG - Intronic
988159500 5:27501946-27501968 GAAAATGGACTAATACAGTTGGG - Intergenic
988289417 5:29266648-29266670 GAGAATGGACTAATACAGATAGG - Intergenic
988593225 5:32567406-32567428 GAGAATGGACTAATACAGGGTGG + Intronic
988644315 5:33077510-33077532 GAAAACGAACTAATACAGTTAGG + Intergenic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
988799168 5:34680213-34680235 GAAAATGGACTAAGACAGTAGGG - Intronic
988924720 5:35978320-35978342 GAAAATGGACTAATACAGAGTGG - Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989289505 5:39747012-39747034 GGGAATGGACTAATACAGCATGG + Intergenic
989350669 5:40482547-40482569 GAAAATGGACCTATGAAGTTGGG + Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989752605 5:44913833-44913855 GAAAACAGACTAATACATCTGGG - Intergenic
990229420 5:53695566-53695588 AAAAATGGACTAATACAAATAGG + Intergenic
990336652 5:54779227-54779249 GAAAATGAACTAATACAGAGGGG + Intergenic
990393059 5:55347679-55347701 CAAAATGGACTAAGACAGCCAGG - Intronic
990480364 5:56204713-56204735 GAGAATGGACTAATACAGGTAGG + Intronic
990558810 5:56963531-56963553 GAAAATTGACTAATACAGTCTGG + Intronic
991158506 5:63467000-63467022 GAAAACGGACTAATACATCAGGG + Intergenic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991259590 5:64652638-64652660 GAAAATGGACTAATACAGAGGGG - Intergenic
991605979 5:68401600-68401622 GAGAATGGACTAATACAGTTTGG - Intergenic
992075906 5:73192486-73192508 GAGAATGGACTAATACACTTGGG + Intergenic
992270524 5:75058405-75058427 GAGAATGGACTAAGATAGCTTGG + Intergenic
992297865 5:75344394-75344416 GAAAATGTACCTTTACAGCATGG - Intronic
992830047 5:80585187-80585209 GGAAACAGACCAATACAACTGGG + Intergenic
992924609 5:81568508-81568530 GAAAACGGACTAATATAGTTTGG + Intronic
993520902 5:88898826-88898848 AAGAATGGATAAATACAGCTGGG - Intronic
993569844 5:89523884-89523906 GAAAATGGACTAATACAAAGGGG - Intergenic
993704513 5:91154592-91154614 GAGAATGGACTAATACAGATAGG - Intronic
993884160 5:93396852-93396874 GAGAATGGACTAATACAGAAGGG + Intergenic
994081973 5:95717032-95717054 GAGAACAGACTAATACAGCTGGG + Intronic
994578472 5:101610540-101610562 GAGAATGGACTAATACACGTGGG - Intergenic
994614089 5:102081590-102081612 GAAAACAGACTAATACAGGTTGG - Intergenic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
994920360 5:106034976-106034998 GAGAATGGACTAATACAGAGGGG - Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995318165 5:110800139-110800161 GAAAATGGACTAATACAGAGAGG - Intergenic
995598182 5:113768907-113768929 GAAAATGAACTAATATAGGTAGG + Intergenic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996515895 5:124368976-124368998 GAAAATGGACTAAAACAGTTGGG - Intergenic
996517628 5:124390402-124390424 GTAAATGGAACAACAAAGCTTGG - Intergenic
996646011 5:125817693-125817715 GCAAATGGACTAACACAGGTGGG + Intergenic
996707510 5:126512415-126512437 GAGAATAGGACAATACAGCTTGG - Intergenic
997177144 5:131790835-131790857 GAACAGGGAGCAGTACAGCTTGG + Intronic
997652151 5:135530417-135530439 GAAAACTGACTAATACAGATGGG - Intergenic
998144983 5:139722345-139722367 GAAAATGGACTAATACAATGGGG + Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
1000220718 5:159211066-159211088 GGAAATGGACCAAGATAGCAAGG + Intergenic
1000238944 5:159391079-159391101 GAAAATGGGCTAATACAAGTAGG - Intergenic
1000418184 5:161006092-161006114 AAGAATGGACTAATACAGTTGGG + Intergenic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1001272904 5:170328946-170328968 GAAAATGGACCATCACAGAAGGG - Intergenic
1001627579 5:173149181-173149203 GAAAACAGACTAATACAGATGGG - Intronic
1002990809 6:2236880-2236902 GAAAATGAACCACCAAAGCTTGG - Intronic
1003180320 6:3785272-3785294 GAGAATGGACTAATACACTTGGG + Intergenic
1003665434 6:8107277-8107299 GAAAATGGACTAATACATGGTGG - Intergenic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1003897825 6:10624203-10624225 GAAAACGGACTAATACACCTTGG - Intronic
1005362733 6:25046990-25047012 GAGAACTGACAAATACAGCTAGG - Intergenic
1005802794 6:29444370-29444392 GAAAACAGACTAATACACCTTGG + Intronic
1005982830 6:30850565-30850587 GAAAACGGACTAATACGGCTGGG + Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1007533692 6:42565279-42565301 ATGAATGGACCAAGACAGCTTGG + Intronic
1007604948 6:43111026-43111048 GAAAATGGACCCAGTCATCTTGG - Intronic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008048866 6:46879644-46879666 AAAAATGGACTAATACATATCGG + Intronic
1009288717 6:61856737-61856759 GAAAATGCACCTGTACACCTAGG - Intronic
1009327630 6:62373638-62373660 GAAAACGGACTAATACAAGTTGG - Intergenic
1009614909 6:65991389-65991411 GAGAATGTACTAATACAACTAGG - Intergenic
1009825207 6:68858135-68858157 GAAAATGGACTAATACAGTCAGG + Intronic
1010132111 6:72506665-72506687 GAGAATGGACTAATAGAGTTGGG - Intergenic
1010757722 6:79686066-79686088 GAAAATGGAACAATACTTCCTGG - Intronic
1011236794 6:85227401-85227423 GAAAATGGACTACTACAGTTAGG - Intergenic
1012188771 6:96255010-96255032 GAAAATGGACTAATACAATTAGG - Intergenic
1012638837 6:101582597-101582619 GAGAATGGACTAATACAGATGGG + Intronic
1012865239 6:104610971-104610993 GAGAATGGACTAATACACCCAGG - Intergenic
1012965026 6:105664703-105664725 GTAAATGGAACAACAAAGCTTGG - Intergenic
1013084936 6:106848348-106848370 GAGAATAGACTAATACAACTGGG + Intergenic
1013086753 6:106863869-106863891 GAAAACAGACTAATACAACTGGG + Intergenic
1013121199 6:107142860-107142882 GAAAATGGTAAAATACAGCCAGG + Intergenic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013859022 6:114610938-114610960 GAGAATGGACTAATAGAGTTAGG + Intergenic
1014147530 6:118015237-118015259 GAAGATGGACTAATACACTTAGG + Intronic
1014248375 6:119091874-119091896 GAGAATGAGCCAATACAGTTGGG + Intronic
1014402360 6:121006343-121006365 GAGAATGGACTAATACAGTAAGG + Intergenic
1014701958 6:124699824-124699846 AAAAACGGACTAATACACCTTGG + Intronic
1014851606 6:126346642-126346664 GAAAATGGACTAATACAATGAGG - Intronic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1014960181 6:127673474-127673496 GAAACTGCACCAATATTGCTGGG + Intergenic
1015584641 6:134762997-134763019 GAAAAGGGGCCAAAACACCTGGG - Intergenic
1015907829 6:138135953-138135975 CAAAATGGACCAATACAGAATGG + Intergenic
1016148524 6:140706353-140706375 GAAAATGGACTAATATGGCTGGG + Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1017123752 6:151047791-151047813 GAGAACAGACCAATACAGCATGG - Intronic
1017524353 6:155229694-155229716 GAAAATGAATTAATACACCTGGG - Intronic
1017631850 6:156403624-156403646 GAGAACGGACTAATACAGATGGG + Intergenic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1018071455 6:160167804-160167826 GAGAATGAATGAATACAGCTGGG + Intergenic
1018182389 6:161235510-161235532 GAGAATGGACTAATCCAGATGGG - Intronic
1018440994 6:163813254-163813276 AAAAATGGACTAATACAGTCAGG + Intergenic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018554732 6:165037499-165037521 GAAAACGGACTAATATAGCAGGG + Intergenic
1018557830 6:165066447-165066469 GAAAATGGACCACCACATGTAGG + Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018614399 6:165672808-165672830 GAAAACGGACTAACACAGATGGG + Intronic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1019896767 7:3989102-3989124 GAAAACCGACTAATACAGATAGG - Intronic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020389875 7:7646653-7646675 GAAAATGAACTAATACAGATGGG + Intronic
1020546809 7:9542567-9542589 GAGAATGGACTAATATATCTAGG + Intergenic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1022592076 7:31673133-31673155 GAAAATGGACTAATACAGTGGGG + Intergenic
1022982627 7:35618682-35618704 GAAAATGGACTAATACAGAGTGG + Intergenic
1023265124 7:38396506-38396528 GAAAATGGACTAATACAATATGG + Intronic
1023932428 7:44713946-44713968 GGGAATGGACAAAGACAGCTTGG - Intergenic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1024684770 7:51733544-51733566 GAAAATGGATTAATACACCAGGG - Intergenic
1024754819 7:52517679-52517701 AAGAATGGACTAATACAGCAAGG - Intergenic
1025223158 7:57133453-57133475 GAAAATGGACTAATACATGCGGG + Intronic
1025719557 7:63997791-63997813 GAAAATGGACTAATACATTCAGG - Intergenic
1025742083 7:64206029-64206051 GAAAATGGACTAATACATGCAGG - Intronic
1025746539 7:64247963-64247985 GAAAATGGACTAATACATGCAGG - Intronic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026619412 7:71937061-71937083 GAAAATGGACTAATACAATTAGG + Intronic
1026655986 7:72256957-72256979 GAAAATGAACTAATACAGTGGGG - Intronic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1027648768 7:80838566-80838588 GAAAATGGACTAATATAGTAGGG - Intronic
1027937996 7:84633395-84633417 GAAAACGAACTAATACAGTTGGG + Intergenic
1028264272 7:88703829-88703851 AAAAATGGACAAATACGGCCAGG - Intergenic
1028393235 7:90338540-90338562 GAGAATGGACTAATACAGGAAGG + Intronic
1028831876 7:95337422-95337444 GAGAATGGACTAATACAGCTGGG - Intergenic
1029441988 7:100591932-100591954 GAAAATGGACTAATACAGGTGGG - Intronic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1029592618 7:101517312-101517334 GAAAACGGACCAATACAGATGGG - Intronic
1029788783 7:102820593-102820615 CAAAATGGACCAAGACATATGGG - Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1030249834 7:107429936-107429958 GAAAACGGACTAATACAGTTGGG + Intronic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1031113987 7:117647263-117647285 AAGGATGGACTAATACAGCTGGG - Intronic
1031432051 7:121683991-121684013 GAAAATAGACTAATACAGAAGGG - Intergenic
1031480049 7:122267371-122267393 GAAAATGAACTAATACAGATGGG + Intergenic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031785378 7:126024351-126024373 GAAAATGGACTAATACAGGCTGG + Intergenic
1032341297 7:131075700-131075722 GAAAATGGACTAAAACAGAGAGG - Intergenic
1033257678 7:139816283-139816305 GAAAATCGGCTAATACAGATGGG + Intronic
1033304941 7:140218445-140218467 GAAAATGGACTAATACCGAAGGG + Intergenic
1033487635 7:141806403-141806425 GAGAATGGACTAATACAGAGGGG + Intergenic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034204186 7:149301426-149301448 AAAAATGGACTAATACACCATGG + Intergenic
1034572768 7:151970298-151970320 GAAAATGGACCATCACATATAGG + Intronic
1034683745 7:152951486-152951508 GAGAATGGACTAATACACATGGG + Intergenic
1034943273 7:155245694-155245716 GAGAATGGACTAATACATCAAGG - Intergenic
1035106677 7:156446830-156446852 GAAAATGGACCAAGACAGGTGGG - Intergenic
1035167017 7:156997212-156997234 GTAAATGGACCAACAAAGCCTGG - Intronic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035840625 8:2809122-2809144 GAAAATGGATGAATACAGACAGG - Intergenic
1036087375 8:5626895-5626917 GAAAATGGACTAATACAGAGGGG + Intergenic
1036726126 8:11222874-11222896 GAGAATGGACTAATACAGAGAGG - Intergenic
1037107854 8:15131490-15131512 GAAAATGGACTAATACACTAAGG + Intronic
1037692337 8:21192749-21192771 ATAAATGAACCAACACAGCTTGG + Intergenic
1038139691 8:24830833-24830855 GAAAACGGACTAATGCTGCTGGG - Intergenic
1038281929 8:26173528-26173550 AAAAATGGACTAGTATAGCTGGG + Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1039422689 8:37456746-37456768 AAAAATTGTGCAATACAGCTGGG - Intergenic
1040012466 8:42673842-42673864 AAAAATGGAACCATACAGCATGG - Intergenic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1040805062 8:51385986-51386008 GAAAATGGACTAATAGACCATGG + Intronic
1041195492 8:55397789-55397811 GAAACTGGACCAAGACACCGAGG - Intronic
1041288073 8:56281347-56281369 GAGAATGGACCAATACACCATGG - Intergenic
1041610801 8:59845839-59845861 GAAAATGTACCTATACACCATGG + Intergenic
1041739444 8:61142429-61142451 GAAAATGGACTAATACAATTGGG + Intronic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1042520300 8:69704439-69704461 AAAAATGGAACAATATAGCTTGG - Intronic
1042613245 8:70620817-70620839 GACAAAGGACTAATTCAGCTTGG + Intronic
1042685188 8:71430933-71430955 GAACATGGAACAAGACAGCTTGG + Intronic
1042923351 8:73941298-73941320 GAAAATGGACTAATACAGAGAGG + Intronic
1043050596 8:75380633-75380655 GAAAATGGACTAATGCCGCATGG + Intergenic
1043360112 8:79462007-79462029 GACAATGGACTAATAGAGATGGG + Intergenic
1043419410 8:80083725-80083747 GAGAATGGACTAGTACACCTTGG + Intronic
1044514658 8:93123983-93124005 CAAAATGGTCCAGTAAAGCTGGG + Intergenic
1044529506 8:93291361-93291383 GAAAATGGACTAACACACCCGGG - Intergenic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1044715752 8:95098212-95098234 GAAAATGGATCACTCCAGATTGG - Intronic
1045405723 8:101864889-101864911 AAAATTGGAACAATCCAGCTGGG - Intronic
1045822527 8:106357259-106357281 AAAAATGAGGCAATACAGCTTGG + Intronic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046367903 8:113260187-113260209 GAGAATGGACCAATACAGGCAGG + Intronic
1046617126 8:116489979-116490001 GAAAATGGACTAATATAGGGTGG - Intergenic
1047195703 8:122719358-122719380 GAAAATGGACTAATACAGTGGGG + Intergenic
1047374242 8:124281145-124281167 GAGAATGGACTAATACAGGTGGG - Intergenic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1047938718 8:129807002-129807024 TAAAATGGACTAATACAGGAAGG + Intergenic
1048128583 8:131665563-131665585 GAGAATGGACTAATACAGATTGG - Intergenic
1048478698 8:134768413-134768435 GAAAATGGACTAATACAGAGAGG - Intergenic
1048622888 8:136153892-136153914 GAGAATGGACTAATACACCATGG + Intergenic
1048759298 8:137774435-137774457 GAAAATGGCACAATAGAGGTGGG - Intergenic
1049456924 8:142697342-142697364 GAAACTGGCCCAAACCAGCTAGG - Intergenic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1050280730 9:4047362-4047384 GAAAACGGACTAATACAATTGGG + Intronic
1051217066 9:14809325-14809347 CAAAATGGACTAATACAGGGAGG + Intronic
1051988312 9:23118754-23118776 GAAAATGGACTAATACAAGTAGG - Intergenic
1052078915 9:24179491-24179513 GAAAATGGACTAATACAGGCAGG - Intergenic
1052195962 9:25715277-25715299 GAAATTAGACCAAGACAGCTAGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052688523 9:31783952-31783974 GAAAATGGACTAATACACTGAGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052742800 9:32410022-32410044 GAAAATTGACCATTACTACTTGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052959832 9:34286036-34286058 GAAACTGGCCCAATAAGGCTGGG + Intronic
1053418288 9:37960671-37960693 GAAAGGGGACCAATCCAGATGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053675534 9:40421741-40421763 GAAAACAGACTAATACAGCTAGG + Intergenic
1053925328 9:43048079-43048101 GAAAACAGACTAATACAGCTAGG + Intergenic
1054288810 9:63260267-63260289 GAAAACAGACTAATACAGCTAGG + Intergenic
1054386632 9:64561804-64561826 GAAAACAGACTAATACAGCTAGG + Intergenic
1054509088 9:65954551-65954573 GAAAACAGACTAATACAGCTAGG - Intergenic
1055330921 9:75183291-75183313 GAAAACGGACTAATGCATCTTGG - Intergenic
1055366933 9:75554804-75554826 GAAAATGAACTAATACATATGGG - Intergenic
1056121817 9:83495739-83495761 GAAAAAGGACCAAAACAACATGG + Intronic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056733362 9:89184311-89184333 GAGAATGGACTAATACAGTGAGG + Intergenic
1056962305 9:91136364-91136386 GAAAATGGACTAATACAAGTGGG - Intergenic
1057317983 9:93982977-93982999 GAAAATGAACTAATATATCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057969125 9:99536546-99536568 GAAAATGTTCCAAGACAGATGGG + Intergenic
1057976898 9:99614789-99614811 AAGAATGGACTAATACACCTAGG + Intergenic
1058086301 9:100752157-100752179 GAAAATGGACTAACACATCAAGG - Intergenic
1058086876 9:100757067-100757089 GAAAATGGACTAATACAAGGGGG + Intergenic
1058736203 9:107896424-107896446 GAAAATGAACTAATACCCCTGGG + Intergenic
1059363523 9:113767102-113767124 GAAAATGGACTAATACAGGCTGG + Intergenic
1059719502 9:116945815-116945837 GAAAACAGACTAATACAGGTGGG - Intronic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061341439 9:129984970-129984992 GAAAATGGACTAATACAATTAGG + Intronic
1185974285 X:4701681-4701703 GAAAATGGACAAATACACTCTGG + Intergenic
1186051767 X:5604177-5604199 GAGAATGGACTAATACAGATGGG - Intergenic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187859355 X:23666561-23666583 GAAAAAGGAACAACACTGCTGGG + Intronic
1188473251 X:30563396-30563418 GAGAATGGACTAATACACATGGG + Intronic
1188736377 X:33721679-33721701 GAGAATGGACTAATACAGTAGGG - Intergenic
1188822253 X:34789783-34789805 GAGAATGGACTAATACAGTCAGG + Intergenic
1188828594 X:34868202-34868224 AAAAATGGACTAATACATCCTGG - Intergenic
1189433206 X:40968056-40968078 GAGAATGGACTAATACAGTAAGG - Intergenic
1189896984 X:45665771-45665793 TAAAATGAACCTATCCAGCTAGG + Intergenic
1190047764 X:47126439-47126461 GAAAATGGACTAATACAGGGAGG - Intergenic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190469578 X:50764801-50764823 GAAAATGGACTAATACAAGTTGG - Intronic
1191749069 X:64521322-64521344 GAACATGGACTAATACAGTCTGG + Intergenic
1192676420 X:73201842-73201864 GAAAATGGACTAATACACTATGG - Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193329807 X:80223389-80223411 AAAAATGGACTAATACAGTTAGG + Intergenic
1193801308 X:85939939-85939961 GAAAATGGACTAATAGAGGCAGG - Intronic
1193827453 X:86243027-86243049 GAGAATGGACTAATATAGATGGG + Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194240660 X:91443354-91443376 AAAAATTTACCAATACACCTTGG - Intergenic
1194335456 X:92640853-92640875 GAAAATGGACTAATAAAAATGGG + Intergenic
1194352547 X:92839080-92839102 GAAAATGGATTAATACAGATGGG - Intergenic
1195565386 X:106333767-106333789 GAAAATAGACTAATACAGGAGGG + Intergenic
1195807389 X:108790399-108790421 GAAAATGGACTAATAGAGTCTGG + Intergenic
1195844688 X:109213508-109213530 GAGAATGGACAAATACAGTCTGG - Intergenic
1196246447 X:113405060-113405082 GAGAATGGACTAATATACCTTGG + Intergenic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196654755 X:118206100-118206122 GAAAAGGGACCAAGAAGGCTTGG + Intergenic
1196970052 X:121098915-121098937 GATAATGGACTAATACAGATGGG - Intergenic
1197114118 X:122811878-122811900 GTAAATGGAACAACAAAGCTTGG + Intergenic
1198083593 X:133262714-133262736 GAAAATGGACTAATACAATTGGG - Intergenic
1198542964 X:137660002-137660024 TAAAATGGAACAATAAAGCATGG + Intergenic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1198863173 X:141092328-141092350 GACAATGAACTAATACAGGTTGG - Intergenic
1198899517 X:141495059-141495081 GACAATGAACTAATACAGGTTGG + Intergenic
1199032594 X:143017646-143017668 GAGAATGAACTAATACAGATAGG + Intergenic
1199219549 X:145301573-145301595 GAAAATGGACTAATGCAGTCAGG + Intergenic
1199387506 X:147240378-147240400 GAAAATGGACTAACACAACAAGG - Intergenic
1199435700 X:147810200-147810222 GAGAATGGACTAATACAAATGGG + Intergenic
1200643928 Y:5757887-5757909 GAAAATGGACTAATAAAAATGGG + Intergenic
1200660857 Y:5955819-5955841 GAAAATGGATTAATACAGATGGG - Intergenic
1200803785 Y:7411366-7411388 GAAAACAGACCAATACAGAAGGG - Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201704478 Y:16921111-16921133 GAAAATGGACTAATGCAGGAAGG - Intergenic