ID: 1104488023

View in Genome Browser
Species Human (GRCh38)
Location 12:129168624-129168646
Sequence GCCCAGGTGGAACCCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104488023_1104488030 17 Left 1104488023 12:129168624-129168646 CCCCAGGGGGGTTCCACCTGGGC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 1104488030 12:129168664-129168686 TTGGATAATTCTATGTTTCGTGG 0: 1
1: 0
2: 3
3: 47
4: 354
1104488023_1104488028 -6 Left 1104488023 12:129168624-129168646 CCCCAGGGGGGTTCCACCTGGGC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 1104488028 12:129168641-129168663 CTGGGCTCTACAGACATTTAAGG 0: 1
1: 0
2: 0
3: 23
4: 210
1104488023_1104488032 19 Left 1104488023 12:129168624-129168646 CCCCAGGGGGGTTCCACCTGGGC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 1104488032 12:129168666-129168688 GGATAATTCTATGTTTCGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 271
1104488023_1104488029 -2 Left 1104488023 12:129168624-129168646 CCCCAGGGGGGTTCCACCTGGGC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 1104488029 12:129168645-129168667 GCTCTACAGACATTTAAGGTTGG 0: 1
1: 0
2: 2
3: 14
4: 174
1104488023_1104488031 18 Left 1104488023 12:129168624-129168646 CCCCAGGGGGGTTCCACCTGGGC 0: 1
1: 0
2: 0
3: 30
4: 168
Right 1104488031 12:129168665-129168687 TGGATAATTCTATGTTTCGTGGG 0: 1
1: 0
2: 3
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104488023 Original CRISPR GCCCAGGTGGAACCCCCCTG GGG (reversed) Intronic
900608754 1:3535639-3535661 GCCCAGCTGGAACCCCAGTGTGG + Intronic
901044268 1:6386081-6386103 GCCCAGGTGGAACTCCGCCCAGG - Intronic
902049885 1:13554914-13554936 GCCGTGGTGGCACCCGCCTGAGG + Intergenic
902454314 1:16521091-16521113 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
902498140 1:16889226-16889248 GCCCTGGTGGAGCCCCCGTGCGG + Intronic
904434095 1:30483107-30483129 GCCCAGGAGGATCCCTCCAGGGG + Intergenic
906528892 1:46512076-46512098 GCCCAGGAGGCCACCCCCTGGGG - Exonic
909863681 1:80638381-80638403 GCACAGGTGGAATCTTCCTGAGG - Intergenic
911632676 1:100200284-100200306 GCCCAGTTCGAACTTCCCTGTGG - Intronic
913450411 1:118989022-118989044 GCCCAGCTGGAATACGCCTGAGG - Intronic
913644654 1:120844772-120844794 GCTCTGGTGGAGCCCCCGTGCGG - Intergenic
914006452 1:143736427-143736449 GCCCTGGTGGAGCCCCGGTGGGG - Intergenic
914082079 1:144418811-144418833 GCCCTGGTGGAGCCCCCGTGCGG + Intergenic
914095363 1:144540126-144540148 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
914099026 1:144568020-144568042 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
914176982 1:145287311-145287333 GCCCTGGTGGAGCCCCCGTGCGG + Intergenic
914201260 1:145487446-145487468 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
914299959 1:146369646-146369668 GCCCTGGTGGAGCCCCCGTGCGG + Intergenic
914303163 1:146393770-146393792 GCCCTGGTGGAGCCCCCGTGCGG + Intergenic
914313405 1:146487076-146487098 GCCCTGGTGGACCCTCCGTGCGG - Intergenic
914480377 1:148060578-148060600 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
914500945 1:148246305-148246327 GCCCTGGTGGACCCTCCGTGCGG + Intergenic
914509400 1:148317856-148317878 GCCCTGGTGGAGCCCGCCTGCGG - Intergenic
914516563 1:148379403-148379425 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
914531712 1:148528803-148528825 GCTCTGGTGGAGCCCCCGTGCGG + Intergenic
914636680 1:149558926-149558948 GCCCTGGTGGAGCCCCCGTGCGG - Intergenic
915947878 1:160167228-160167250 GCCCAGGTAGCATGCCCCTGGGG + Intronic
917612475 1:176702601-176702623 GTCCAGGTGTGACCTCCCTGTGG - Exonic
919791110 1:201291581-201291603 GCCCTGGTGCAAGCCCCCCGGGG + Intronic
924440553 1:244082154-244082176 GCCCAGCTGGAGCCCCTGTGAGG + Intergenic
1067204260 10:44199962-44199984 GCACAGGGGAAACCCTCCTGTGG + Intergenic
1070395669 10:76009630-76009652 GCCTAGGGGGAACCTCCCAGTGG + Intronic
1070406830 10:76104790-76104812 CCCCATATGGAACCCCCCTCTGG + Intronic
1073180567 10:101580544-101580566 GCCCAGGGGAATCCACCCTGAGG + Intronic
1074115963 10:110457741-110457763 TCCCAGCTGGAACCCCTCTCTGG + Intergenic
1074205236 10:111277388-111277410 GCCCAGGGGCAACTGCCCTGGGG + Intergenic
1074291381 10:112140249-112140271 GACCAGGTGGACGCCTCCTGGGG - Intergenic
1075996099 10:126877543-126877565 GCTCAGGTGCAACCGCACTGAGG - Intergenic
1076221140 10:128734059-128734081 GCAGAGCTGGAACCCCCGTGTGG + Intergenic
1076634944 10:131875842-131875864 GTCCAGGTGGAAGCCCCTTCAGG - Intergenic
1077038691 11:507678-507700 ACCCGGGAGAAACCCCCCTGGGG + Intergenic
1077062019 11:621702-621724 GCCCCTGTGGACCCCCACTGTGG + Intronic
1077101966 11:826337-826359 GCCCGAGTGAAACCCTCCTGTGG - Intronic
1078335806 11:10462415-10462437 GCCAAGGTGGAGTCGCCCTGGGG + Intronic
1079510556 11:21205375-21205397 ACCCAGTTGGAACTTCCCTGCGG + Intronic
1081383008 11:42438966-42438988 CTCCAGGTGGAATTCCCCTGTGG + Intergenic
1082262971 11:50091369-50091391 ACCCAGGTGGCATGCCCCTGTGG + Intergenic
1083516204 11:63261577-63261599 GCCCAGTTGGAACTTCGCTGTGG + Intronic
1084033786 11:66495756-66495778 GCCTAGGTGGAGCCCCCTGGAGG + Intronic
1090422582 11:126585676-126585698 GCCCCGGGGGAAGCCTCCTGCGG + Intronic
1091623423 12:2106220-2106242 GCTCAGGTGGAAACCCTCTCCGG - Intronic
1091905908 12:4188953-4188975 GCTCTGGTTGAAGCCCCCTGAGG - Intergenic
1103002870 12:117399081-117399103 CCCCAGGTGCAACCACCCTTAGG - Intronic
1104488023 12:129168624-129168646 GCCCAGGTGGAACCCCCCTGGGG - Intronic
1107454916 13:40546188-40546210 GCCGAGGTGGGAGCCGCCTGGGG - Intergenic
1108360729 13:49666087-49666109 TCCCAGGTGCAACCCCTATGTGG - Intronic
1116565425 14:46438864-46438886 GCCCAGTTCGAACTCCCCTGGGG - Intergenic
1117237989 14:53798591-53798613 GCCCAGTTGAAACATCCCTGTGG - Intergenic
1117571683 14:57055367-57055389 ACCCAGGTGAGACACCCCTGGGG + Intergenic
1118247605 14:64126536-64126558 GCCCACGTGGAAGCCTCTTGAGG + Intronic
1118665555 14:68065379-68065401 GCTCAGGTGCTACTCCCCTGGGG + Intronic
1120829848 14:88988067-88988089 GGCAAGGTGGCACCCGCCTGTGG + Intergenic
1121492096 14:94368281-94368303 GCCCCTGTGGAGCACCCCTGGGG + Intergenic
1122145448 14:99685910-99685932 GAGCAGGAGGAACCTCCCTGAGG - Intronic
1122980704 14:105191259-105191281 GCCCAGGAAGAACCACCCAGAGG - Intergenic
1124002010 15:25767688-25767710 GCCGAGGTGGGATTCCCCTGAGG - Intronic
1124696028 15:31865016-31865038 GCCCTTGTGGCCCCCCCCTGGGG + Intronic
1128061713 15:64739562-64739584 CCCCAGGTGGGACCTTCCTGGGG - Intergenic
1128727785 15:70000544-70000566 ACCCAGATGGAGCCCCACTGAGG - Intergenic
1129766097 15:78168829-78168851 GCCCAGGTGGCATCTCACTGAGG + Exonic
1132330006 15:101005742-101005764 GTCCAGGGGGAGCCCCACTGGGG - Intronic
1136271004 16:29148232-29148254 GCCCAGGAGGCAGCCCCCCGGGG - Intergenic
1137563040 16:49515238-49515260 GCCCAGGTGGGAACGCCATGGGG - Intronic
1141662362 16:85448323-85448345 GCCAGGGTGGAAGACCCCTGGGG + Intergenic
1143258678 17:5582800-5582822 GCCCAAGTGAACCCCACCTGGGG - Exonic
1144083613 17:11786851-11786873 GCCTGAGTGGAAACCCCCTGAGG + Intronic
1144947548 17:18977660-18977682 GCCCATGGGGAGCCACCCTGGGG + Exonic
1145784061 17:27582751-27582773 GCCCAGCTGGGAGCTCCCTGGGG - Exonic
1147438022 17:40429931-40429953 GCCCCTGGGGAACCCCCCAGGGG + Intergenic
1147956550 17:44138489-44138511 GCCCAGGTGGGGCTCCACTGGGG + Intergenic
1148442416 17:47718347-47718369 GCCCAGGTGCAGCCCTCCTTGGG - Intergenic
1151662442 17:75525862-75525884 CCCCAGGTGGAAGCCCCGAGGGG - Intronic
1151728598 17:75898205-75898227 GGGCCGGTGGGACCCCCCTGAGG + Intergenic
1152570368 17:81118982-81119004 GCCCAGGTGGAGCCCTGCTGGGG - Intronic
1152778375 17:82215742-82215764 GCCCAGGTGGAGCCCAGCTGGGG - Intergenic
1153667497 18:7379337-7379359 CCCCAGGTGGAAGCCACGTGGGG + Intergenic
1155939956 18:31793075-31793097 GCCCAGGTGGGAGCTACCTGTGG - Intergenic
1157186037 18:45540773-45540795 GCCAGGGTGGAAGCTCCCTGAGG + Intronic
1158857141 18:61554332-61554354 GGCCATGTGGAACCCCCGGGAGG + Exonic
1160797529 19:952877-952899 GCCCAGGTGGGGCCTGCCTGGGG + Intronic
1161171633 19:2815180-2815202 GACCAGGTGGAGGCCACCTGAGG - Exonic
1161590804 19:5128348-5128370 GCCCAGGAGGGCCCCACCTGGGG - Intronic
1162452101 19:10761440-10761462 TCCCAGCTGGAAACCCCCTCGGG + Intronic
1162605032 19:11700086-11700108 GCCCAGGTTGAATCCACCTGTGG + Intergenic
1162680489 19:12336918-12336940 GCCCAGGTTGAATTCACCTGTGG + Intergenic
1166012261 19:39951229-39951251 GCCCAGTTGGAGCCACACTGGGG + Intergenic
1167465989 19:49651398-49651420 GCCCGGGTGGAGTCCACCTGGGG - Exonic
1167910172 19:52695349-52695371 GCCATGGTGGAACTCACCTGTGG + Intergenic
1168123992 19:54272796-54272818 GCCCTGGTGGAAACCCTCTCTGG + Intronic
1168178374 19:54642738-54642760 GCCCTGGTGGAAACCCTCTCTGG - Intronic
1168658864 19:58150622-58150644 ACCCAGGTGAAACCCACCCGCGG + Intronic
925056633 2:861837-861859 GACCAGGTGGAGCCTCCCTGAGG + Intergenic
926692347 2:15746163-15746185 GCTCAGATGGGACCCCGCTGAGG + Intergenic
927033770 2:19150653-19150675 GCAAAGGTGGAACCCTCATGGGG - Intergenic
927240201 2:20914325-20914347 TCCCAAGTGCAACCCCCATGTGG + Intergenic
929121147 2:38484930-38484952 GAGCAGCAGGAACCCCCCTGAGG + Intergenic
929511277 2:42568200-42568222 GTCCCTGGGGAACCCCCCTGTGG - Intronic
932899522 2:75681822-75681844 GCCCAGGTCGAACTTCCCGGTGG - Intronic
934529245 2:95074961-95074983 GGCCAGGTGGAACCGCCAAGGGG + Intergenic
934751493 2:96797006-96797028 GGCCAGGTGGGACTTCCCTGTGG - Exonic
934755966 2:96825052-96825074 GGCCAGGTGGGACTTCCCTGTGG - Exonic
935325855 2:101936046-101936068 GCCCAGTTTGAACTTCCCTGCGG - Intergenic
940821418 2:158360053-158360075 GCCCAGTTGGAACTTCCCTGTGG - Intronic
943408747 2:187519910-187519932 GCCCAGTTGGAACTTCCCTGGGG + Intronic
946397916 2:219452566-219452588 ACCCAGTGGGAACCCCCTTGAGG - Intronic
947633155 2:231666492-231666514 ACCCAGGAGGAACCGCCCTGAGG - Intergenic
947895031 2:233663154-233663176 GCCCTGGTGTAACCACCCGGGGG + Intronic
948054979 2:235004245-235004267 GCCCATGAGGAACCCATCTGAGG - Intronic
948491539 2:238316236-238316258 GCCAAGATGGAATCCCTCTGAGG + Intergenic
948846865 2:240687485-240687507 GCCCAGGAGGCACCTCCCTCAGG - Intergenic
948999235 2:241602871-241602893 GCCCATGTGCAACCCTGCTGAGG - Intronic
1172062590 20:32196646-32196668 GCCCCCGTGTAACCCACCTGGGG - Exonic
1176194095 20:63829188-63829210 GCCCTGGTGGAACTGACCTGGGG + Intronic
1177042687 21:16132956-16132978 GCCCAGTTCGAACTTCCCTGAGG + Intergenic
1178389271 21:32185198-32185220 CCCCAGGTGGAAACCAGCTGTGG - Intergenic
1179783338 21:43716506-43716528 CCCCAGGTGGAACCCAGCTCTGG + Intergenic
1180080936 21:45487263-45487285 GCCTGGGTGGAGCCCCCCCGGGG - Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1184128678 22:42504475-42504497 GCCCAGGAGGAAGCCCCTGGGGG - Intergenic
1184137473 22:42557790-42557812 GCCCAGGAGGAAGCCCCTGGGGG - Intronic
1184229717 22:43151961-43151983 TCCCAGGCGGAACTCCCTTGAGG + Exonic
1184250957 22:43260047-43260069 ACCCAGGTGGAACCCACTTTGGG + Intronic
950051469 3:9993836-9993858 ACCAAGGTGGAACATCCCTGGGG + Intronic
950058364 3:10047566-10047588 ACCAAGGTGGAACATCCCTGGGG + Intronic
950435302 3:12975866-12975888 GCCCAGGAGGAAGACCTCTGCGG + Intronic
950561962 3:13736138-13736160 GCCCATTTGGAACCTCCCAGCGG + Intergenic
951478200 3:23130881-23130903 GCCAATGTGGAAACCCCCTGAGG - Intergenic
954683325 3:52357730-52357752 GGCCAGGTGGCGCCCACCTGGGG - Exonic
962668411 3:137679722-137679744 GCCCAGTTTGAACTTCCCTGTGG - Intergenic
964711546 3:159676735-159676757 GCCCAGGTGGCAGCCCTCTTGGG - Intronic
967458870 3:189722146-189722168 GCTCAGGTGGAAGCTCTCTGGGG + Intronic
968046186 3:195624932-195624954 GCTCAGGCGGAAACCCCCCGGGG - Intergenic
968308468 3:197665155-197665177 GCTCAGGCGGAAACCCCCCGGGG + Intergenic
968658171 4:1787477-1787499 GCTCAGCTGAAACCTCCCTGGGG + Intergenic
973948295 4:55983752-55983774 GCCAAGGTGGACCCCACCTGAGG - Intronic
974029339 4:56762190-56762212 GCCCAGGTGTAACCACCCAGTGG - Intergenic
975055533 4:69924714-69924736 GCCCATGTGGCAACCCGCTGGGG + Intergenic
976367229 4:84245275-84245297 GCCCCCGTGTAACCCACCTGGGG + Intergenic
977325659 4:95572102-95572124 GGCCTGGTGGAACCCCCATGTGG - Intergenic
979588243 4:122446067-122446089 GCCCGGGTGGAACTTCCCGGTGG + Intergenic
983622683 4:169776528-169776550 GGCCAGGTGGTACTCACCTGTGG + Intergenic
985720642 5:1486883-1486905 GACCCCGTGGAACCCACCTGGGG + Intronic
985747125 5:1653943-1653965 GCTCAGGCGGAAACCCCCCGGGG + Intergenic
993891705 5:93482829-93482851 GCCCAGTTGGAACTTCCCAGAGG - Intergenic
994622452 5:102179272-102179294 GCCCAGTTCGAACCTCCCAGAGG + Intergenic
996693912 5:126371562-126371584 GCCCAGGCTGTACCCACCTGAGG - Intronic
997857369 5:137384154-137384176 GCCCAGGTGGAATCCCCATAGGG - Intronic
998365478 5:141628073-141628095 GCCCAGGCAGAACACTCCTGAGG + Intronic
999114014 5:149145923-149145945 GGCCTGGTGGCACCCACCTGCGG - Intronic
1002095519 5:176828571-176828593 GCCCAGGGGGAACCTCGCTGAGG - Intronic
1007328279 6:41080850-41080872 GCCCAGGTGGCATCCGCCTCAGG + Exonic
1007617082 6:43186544-43186566 ACCCAAGAAGAACCCCCCTGGGG + Intronic
1008868872 6:56247932-56247954 GCCCAAGAAGAACCCCCCTCTGG + Intronic
1012457606 6:99424890-99424912 GCGCAGTGGGAACCCCCTTGTGG - Intronic
1014752310 6:125269301-125269323 GCCCATGCGGGAGCCCCCTGTGG - Intronic
1016590900 6:145742311-145742333 GCCCAGTTTGAACCTCCCAGTGG - Intergenic
1019155973 6:170039263-170039285 GCCCATGTGGAAACACCATGAGG - Intergenic
1019399482 7:844116-844138 GCCCAGGAGGAGGCCCCCCGCGG - Intronic
1026665283 7:72336253-72336275 GCCCAGGTGGGAGCGCCCGGCGG - Intronic
1028991274 7:97051287-97051309 ACCCAGTTTGAACCTCCCTGCGG - Intergenic
1029906939 7:104101950-104101972 GCAGAGGTGGAACCTCCCTAGGG + Intergenic
1034715095 7:153234754-153234776 GCCCAGTTTGAACTTCCCTGCGG + Intergenic
1035202482 7:157276363-157276385 GCCCAGCTGGGACCCCAGTGTGG + Intergenic
1036070315 8:5435354-5435376 GCCCTGTTGGAATCCCACTGTGG - Intergenic
1036824271 8:11964046-11964068 TCCCGGGTGGAACAGCCCTGAGG - Intergenic
1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG + Intronic
1038349521 8:26763280-26763302 GCCCAAGTGGAAGTCCCCAGAGG - Intronic
1042574078 8:70198879-70198901 GCACCTGTGGAACACCCCTGTGG + Intronic
1043366303 8:79537202-79537224 GCCCAGTTTGAACTTCCCTGTGG + Intergenic
1044370043 8:91399590-91399612 CACCTGGTGGAACCACCCTGTGG - Intergenic
1044460503 8:92438954-92438976 TCCCAAGTGGAAGCACCCTGAGG - Intergenic
1049425298 8:142535468-142535490 GCCCAGGTGGAAGCCATCTCTGG - Intronic
1055690897 9:78829429-78829451 GCCCAGTGGGAACCACCATGTGG + Intergenic
1059437307 9:114284508-114284530 TCCCAGCTGGAACACCCCTTTGG + Intronic
1060045453 9:120336813-120336835 GACCACATGGAACCCCACTGAGG - Intergenic
1061069602 9:128301088-128301110 TCCCTGGGGGAAGCCCCCTGGGG + Intergenic
1061246397 9:129403032-129403054 GCTCTGGTGGGACCCCCATGTGG + Intergenic
1061630974 9:131872019-131872041 GCCCAGGAGCATGCCCCCTGGGG - Intronic
1061765444 9:132878498-132878520 GCCCAGCTGGAAGCCACCTGAGG - Exonic
1062398287 9:136361437-136361459 GCCCAGGTGGCTCCCCCGGGAGG + Intronic
1062506799 9:136881767-136881789 GCCCTGGGGGAGCCCCCCTGGGG + Intronic
1203775302 EBV:69602-69624 GCCCAGGTACAGCCCCCCGGAGG - Intergenic
1185912231 X:3992614-3992636 GCCCAGATGGAAGTCCACTGTGG - Intergenic
1187533583 X:20117511-20117533 GCCCAACTGGCACCCACCTGGGG - Intergenic
1193079363 X:77390582-77390604 TCCCAGTTGGAACTTCCCTGGGG - Intergenic
1200078921 X:153566044-153566066 GCCCATGGGGACCCCACCTGCGG + Intronic
1201648571 Y:16261942-16261964 GCCTAGGAGGAACCCCCTTCAGG - Intergenic
1201654239 Y:16323359-16323381 GCCTAGGAGGAACCCCCTTCAGG + Intergenic
1202100559 Y:21303664-21303686 GCCATGCTGGAACACCCCTGTGG - Intergenic