ID: 1104491769

View in Genome Browser
Species Human (GRCh38)
Location 12:129200541-129200563
Sequence ACCCCAAGAGTTTAGCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104491769_1104491777 20 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491777 12:129200584-129200606 GGAGTTATAGGATCTGCAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 155
1104491769_1104491773 -2 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491773 12:129200562-129200584 GTGGGGACAAAAAAGCTGATCGG 0: 1
1: 0
2: 0
3: 14
4: 195
1104491769_1104491774 -1 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491774 12:129200563-129200585 TGGGGACAAAAAAGCTGATCGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1104491769_1104491775 8 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491775 12:129200572-129200594 AAAAGCTGATCGGGAGTTATAGG 0: 1
1: 0
2: 2
3: 9
4: 87
1104491769_1104491776 17 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491776 12:129200581-129200603 TCGGGAGTTATAGGATCTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104491769 Original CRISPR ACCCCAAGAGTTTAGCCAAA TGG (reversed) Intronic