ID: 1104491776 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:129200581-129200603 |
| Sequence | TCGGGAGTTATAGGATCTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 40 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104491769_1104491776 | 17 | Left | 1104491769 | 12:129200541-129200563 | CCATTTGGCTAAACTCTTGGGGT | 0: 1 1: 0 2: 1 3: 18 4: 90 |
||
| Right | 1104491776 | 12:129200581-129200603 | TCGGGAGTTATAGGATCTGCAGG | 0: 1 1: 0 2: 0 3: 2 4: 37 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104491776 | Original CRISPR | TCGGGAGTTATAGGATCTGC AGG | Intronic | ||