ID: 1104491776

View in Genome Browser
Species Human (GRCh38)
Location 12:129200581-129200603
Sequence TCGGGAGTTATAGGATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104491769_1104491776 17 Left 1104491769 12:129200541-129200563 CCATTTGGCTAAACTCTTGGGGT 0: 1
1: 0
2: 1
3: 18
4: 90
Right 1104491776 12:129200581-129200603 TCGGGAGTTATAGGATCTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104491776 Original CRISPR TCGGGAGTTATAGGATCTGC AGG Intronic