ID: 1104492133

View in Genome Browser
Species Human (GRCh38)
Location 12:129203487-129203509
Sequence GGTCCCAGGAAGCATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104492122_1104492133 20 Left 1104492122 12:129203444-129203466 CCCTGCTTCTGTGGGAACTCAGC 0: 3
1: 4
2: 5
3: 31
4: 230
Right 1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 307
1104492123_1104492133 19 Left 1104492123 12:129203445-129203467 CCTGCTTCTGTGGGAACTCAGCC 0: 1
1: 11
2: 19
3: 72
4: 278
Right 1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 307
1104492121_1104492133 27 Left 1104492121 12:129203437-129203459 CCAGTGGCCCTGCTTCTGTGGGA 0: 3
1: 2
2: 12
3: 59
4: 334
Right 1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 307
1104492126_1104492133 -2 Left 1104492126 12:129203466-129203488 CCAGTGGGTGCAGCCTCCTGTGG 0: 1
1: 1
2: 5
3: 37
4: 319
Right 1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104492133 Original CRISPR GGTCCCAGGAAGCATGTGGA GGG Intronic
900261476 1:1732458-1732480 GGACGCAGGAAGCATGGGGCAGG + Exonic
901452297 1:9343259-9343281 GGGGCCAGGAAGCAGGGGGATGG - Intronic
901480356 1:9520744-9520766 GGTTCCAGGAAGCACAGGGAGGG - Intergenic
902051154 1:13564563-13564585 GGTATCAGGAATAATGTGGAAGG - Intergenic
902810168 1:18883535-18883557 GGGACCAGGAAACATTTGGAGGG + Intronic
903012910 1:20343508-20343530 GGACCCGGGAAGCAGGTGGGCGG - Intronic
903175579 1:21578183-21578205 GGTCCCAGGAAGCCGGTGCCTGG + Exonic
903238511 1:21966710-21966732 GATCCCAAGAAGCATGTGTAGGG - Intergenic
903446876 1:23428100-23428122 GATCCCAGGAAGCATAATGAGGG - Intergenic
903869783 1:26425590-26425612 GGTCCCTGGCAGCATCTGGAAGG + Intronic
904538160 1:31215000-31215022 GTTCCCAGTCAGCATCTGGAAGG + Intronic
905473231 1:38208268-38208290 GGTCCCAGGAGGCAGGAGGCAGG + Intergenic
905547002 1:38807848-38807870 AGACCCAGGAGGAATGTGGATGG - Intergenic
907855506 1:58299883-58299905 GCCTCCAGGAAGCATGTGGAGGG - Intronic
908140422 1:61178845-61178867 GATCCCAGGAAGTATGGTGAGGG + Intronic
909472683 1:76046845-76046867 GATACCAGGAAACATGAGGAAGG + Intergenic
910260912 1:85292969-85292991 GATCCCAGGAAGCATTGGCAAGG + Intergenic
911071416 1:93834843-93834865 GGTATCAGGAATAATGTGGAAGG - Intronic
915073735 1:153292806-153292828 GAGCCCAGGAAGCATGGGGAAGG + Intergenic
915087868 1:153400324-153400346 GGGCCCAGGTAGCATCTGTAGGG - Intergenic
915198242 1:154206556-154206578 GGTCCCAAGGAGTATGTGTATGG + Intergenic
915555432 1:156658291-156658313 GGTCCCAGCAAGGAAGTGGAGGG + Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916457590 1:164986809-164986831 AGGCCCAGGAAACATGTGGTGGG - Intergenic
917472365 1:175336735-175336757 GACCCCAGGAAGAATGGGGAAGG + Intronic
918304175 1:183230799-183230821 GGTCTTAGGAATCATGTGGCAGG - Intronic
919205534 1:194417737-194417759 AGTCCCAGGATACATGTGTAGGG - Intergenic
919801994 1:201359715-201359737 GGTCCCAGGTGGCCTGGGGATGG + Intronic
919818284 1:201455858-201455880 GGTGCCTGGAAGGATGTGGGAGG - Intergenic
919922969 1:202177295-202177317 GGACCCATGAGGCATGGGGAAGG + Intergenic
920249032 1:204610169-204610191 GGTCCCAGGATGCATGGGGGTGG - Intergenic
920968311 1:210720505-210720527 AGTCTCAGGAAGAATGTGGAAGG + Intronic
921332883 1:214057552-214057574 GGACCCAGGAAGATTGAGGATGG - Intergenic
921728556 1:218551669-218551691 TGTCCCAGGAAGAGTTTGGAAGG + Intergenic
922184800 1:223264806-223264828 GGTCTCAGGCAGCCTGTGGAAGG + Exonic
922216783 1:223526451-223526473 GGTCCCCGGGAGCATGTCGCTGG + Intergenic
922353204 1:224752331-224752353 GGTCCCAGTGGGCATATGGATGG - Intergenic
922563994 1:226589389-226589411 GCTCCCAGGACGGAAGTGGAGGG + Intronic
922582007 1:226705576-226705598 TGACCCAGGAAGCTTGGGGAAGG - Intronic
922631552 1:227118992-227119014 GGTGCCAGGAAGGAGATGGAGGG - Intronic
924919401 1:248611980-248612002 GGGCCCAAGAAACATGTGAAAGG + Intergenic
1062888611 10:1038692-1038714 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888628 10:1038755-1038777 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888645 10:1038818-1038840 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888662 10:1038881-1038903 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888696 10:1039007-1039029 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888713 10:1039070-1039092 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888730 10:1039133-1039155 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1062888747 10:1039196-1039218 GTCCCCAGGGAGCAGGTGGAGGG + Intergenic
1063393174 10:5663459-5663481 TGGCCCAGGGAGCATGGGGAGGG + Intronic
1067277396 10:44847700-44847722 TGTCCCAGGACGTAAGTGGAGGG + Intergenic
1069045249 10:63736600-63736622 GGACCCAGTGAGAATGTGGATGG - Intergenic
1070650639 10:78233103-78233125 GGTACCAGGAAGCATGAGACTGG - Intergenic
1071390910 10:85174614-85174636 GCTTCCAGGATGCAGGTGGAAGG - Intergenic
1071825655 10:89322839-89322861 TCTCCCAGGAAGCACCTGGAGGG + Intronic
1072797849 10:98369990-98370012 GGTCCAAGGCAGGAGGTGGACGG - Intergenic
1074009708 10:109465437-109465459 GGTCCCTGGAAGATTGTGGGTGG + Intergenic
1074442575 10:113491694-113491716 GATCCCAGGAAGCATGATGAGGG - Intergenic
1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG + Intronic
1075595800 10:123728196-123728218 GGTTCCAGGAAGCAGGAGGGAGG - Intronic
1076061357 10:127416622-127416644 GGTCCCAGGTGGCACGAGGAGGG - Intronic
1076065466 10:127444519-127444541 TGTCCCAGGGTCCATGTGGAGGG + Intronic
1076222538 10:128746045-128746067 GTTCCCAGGGCACATGTGGAGGG + Intergenic
1077014458 11:393574-393596 CGCACCAGGAAGCATGTGGATGG - Intronic
1077217358 11:1400526-1400548 GTGCCCAGGAAGGATGTGGACGG - Intronic
1077352526 11:2099546-2099568 GGTCCCAGGGAGCAGGTGCTGGG - Intergenic
1079404417 11:20132158-20132180 GGTGCCAGGCCGAATGTGGATGG - Intergenic
1079607292 11:22385779-22385801 GGTACCAGGAATATTGTGGAGGG + Intergenic
1084100488 11:66944884-66944906 GGCCCCAGGAAGCTTGTAGGTGG - Intronic
1085692032 11:78671862-78671884 GGTCCCAAGAGGCATCAGGATGG - Intronic
1088127494 11:106446513-106446535 GCTGCCAGGAAGATTGTGGAAGG + Intergenic
1089003599 11:115072380-115072402 GGTCTCTGGAGCCATGTGGATGG - Intergenic
1089282999 11:117387426-117387448 GGCCCCAGGAAGCATGCCTAAGG - Intronic
1089864306 11:121618300-121618322 CACCCCAGGAAGTATGTGGAGGG - Intronic
1090068672 11:123525494-123525516 GGTGCCAGGAAGGAAGAGGAGGG - Intergenic
1090272642 11:125398639-125398661 GGTCTCAGGAAGGAGGTGGCAGG - Intronic
1090406779 11:126480738-126480760 GGCCCCAGGAAGCATGAGCCTGG + Intronic
1091130362 11:133141607-133141629 GGTCCCAGGAGGCAGGAGAAAGG - Intronic
1091858792 12:3760192-3760214 GGTTCCAGGAAGCATGTCTGGGG - Intronic
1091968365 12:4764495-4764517 GGGCCCTGGCACCATGTGGAAGG + Intronic
1092626513 12:10334784-10334806 GGTCTCAGGAATAATGTGGGAGG + Intergenic
1093131177 12:15393143-15393165 GCTCCAAGAAAACATGTGGAAGG - Intronic
1093812559 12:23507678-23507700 GGTATCAGGAATAATGTGGAAGG + Intergenic
1094796802 12:33983382-33983404 GGCACCAGGAAACATTTGGAAGG + Intergenic
1096523615 12:52198088-52198110 GAGCCCAGGCAGGATGTGGAAGG + Intergenic
1096914603 12:55017718-55017740 TGGCCCAGGAACCATGTGGGGGG + Intergenic
1101308853 12:103557736-103557758 GGTCCCAGGAAACACGGGTAGGG - Intergenic
1102162240 12:110778889-110778911 GATCACAGGAAGCCAGTGGAAGG + Intergenic
1102414660 12:112750304-112750326 GGTCCCAGGAAACACTAGGAGGG + Intronic
1102709716 12:114915430-114915452 GATCTCAAGAAGCATGTGCAAGG + Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1103182944 12:118929866-118929888 GCTCTCAGGAAGGATGTTGAGGG + Intergenic
1103270314 12:119668137-119668159 GGTCCCAAGGAGCCTGCGGAAGG - Exonic
1104143773 12:126012706-126012728 GGTCCCCAGAGGCACGTGGATGG - Intergenic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1104527625 12:129539142-129539164 TGTCCCAGGAAGGATGGGGCTGG + Intronic
1104997059 12:132664655-132664677 GTGCCCAGGAAGGATCTGGAAGG + Intronic
1105303468 13:19154233-19154255 GGTCCCAGGCAGCAGCTGGGTGG + Intergenic
1107423243 13:40269150-40269172 GCTTCCAGGAAGCTTATGGATGG - Intergenic
1108233105 13:48370887-48370909 GCCCCTAGGAAGCATCTGGATGG - Intronic
1111986356 13:95070493-95070515 GGCCCCAGGACACATGTGAAAGG + Intronic
1112998091 13:105598828-105598850 GATGCCAGGAAGCTAGTGGAGGG + Intergenic
1113027980 13:105962121-105962143 GGTAGCAGGAAGCATGACGAAGG + Intergenic
1118889586 14:69897026-69897048 GATCCCAGAAATCATGAGGAGGG - Intronic
1120829364 14:88984515-88984537 TGCCCCAGGAAGAAGGTGGAGGG - Intergenic
1121092383 14:91191585-91191607 GGTGCCACGAAGCATGTGGGAGG - Intronic
1123069848 14:105637397-105637419 GGTCCCAGGTAGAAAGTGGGAGG + Intergenic
1123089082 14:105734185-105734207 GGTCCCAGGTAGAAAGTGGGAGG + Intergenic
1126963959 15:54030145-54030167 GGTCCCTGGAAGCAGGAAGAGGG - Intronic
1127847881 15:62887348-62887370 GGTCCCAGGTGGCCTGTGGACGG - Intergenic
1128893255 15:71349881-71349903 GGTCTCAGGAAGGAGGTGGAGGG + Intronic
1129318236 15:74759157-74759179 AGGCTCAGGAAGCATGAGGAGGG + Intergenic
1129748086 15:78038885-78038907 GGCCCCTGGGAGCATGTGAATGG + Intronic
1132116078 15:99137395-99137417 GGGCCCAGGAGGCAGGTGTAAGG - Exonic
1133397101 16:5456823-5456845 GGTCTCAGGAGCCATGTGAAAGG - Intergenic
1133855039 16:9541697-9541719 GGTCCCAGGAAACTTGGGAAGGG + Intergenic
1134030527 16:10988926-10988948 GGTCCCAGGTAGGAGGTGGAAGG - Intronic
1135057327 16:19241700-19241722 GGGCGCAGGAAGGAGGTGGATGG - Intronic
1135436124 16:22427846-22427868 GGACCCAGGACGCAGGAGGATGG + Intronic
1135920323 16:26643665-26643687 GATCCCAGGAAGCCTGATGAGGG + Intergenic
1135992983 16:27228836-27228858 GGTACCATGATGCATCTGGAGGG - Intronic
1136026832 16:27474086-27474108 GGTTCCGGGAAGCCAGTGGAAGG - Intronic
1136077406 16:27826535-27826557 GGTCCCAGGAACTATGGGTAGGG + Intronic
1137055069 16:35741501-35741523 GGTCTCAGGAATAATGTGGGAGG + Intergenic
1139695089 16:68668444-68668466 GGTGCCAGGAAGCATCTGGGAGG + Intronic
1140236663 16:73165422-73165444 GGGCCCAGGCAGAGTGTGGATGG - Intergenic
1140251869 16:73301481-73301503 GGTTCCAGTAGGCATCTGGAGGG - Intergenic
1140409717 16:74734436-74734458 GGGCCCAGGAAGCAGATGCAAGG + Intronic
1141771686 16:86093457-86093479 GGACCCAGGAAAACTGTGGATGG + Intergenic
1141844800 16:86600709-86600731 GCTCCCAGAAAGTAAGTGGAGGG - Intergenic
1142045336 16:87921677-87921699 GGACCCAGGAGGCAGGAGGATGG + Intronic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142508386 17:380351-380373 GCTTCCGGGAAGCATGAGGAGGG - Intronic
1142508400 17:380395-380417 GCTTCCGGGAAGCATGAGGAGGG - Intronic
1142508610 17:380968-380990 GCTTCCGGGAAGCATGAGGAGGG - Intronic
1142508705 17:381233-381255 GGTTCCGGGAAGCATGAGGAGGG - Intronic
1142508778 17:381414-381436 GCTTCCGGGAAGCATGAGGAGGG - Intronic
1144671770 17:17136838-17136860 GGGCCCAGGCAGAATGCGGATGG - Intronic
1144952382 17:19001213-19001235 GGTCCCAGGACAGATGTGGCAGG + Intronic
1145993035 17:29090603-29090625 GGTCCCGGGAAGCCTGGGAAAGG + Exonic
1146692933 17:34889235-34889257 GGTGGCAGGAAGCATGAGGAGGG - Intergenic
1147978573 17:44261420-44261442 GATCCCAGGAAACAGGTGGGAGG - Intronic
1148217298 17:45840157-45840179 GGTCTCAGGAAGGGTGGGGAAGG - Intergenic
1149342075 17:55697814-55697836 GGTCTCAAGGAGCAAGTGGAAGG - Intergenic
1152361880 17:79836650-79836672 GGTCCAAGGAGGCATGGGGGTGG - Intronic
1152532525 17:80927575-80927597 GTTCCCCAGAGGCATGTGGAAGG + Intronic
1153519675 18:5939950-5939972 GGGCCCAAGAAGCAGGTGCATGG - Intergenic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156771021 18:40725330-40725352 GGTTGCAGAAAGTATGTGGATGG + Intergenic
1157003869 18:43559254-43559276 TGTCCCAGGAAGCACCTGGATGG - Intergenic
1157346672 18:46842760-46842782 GGTTCTAGGAGGCATGCGGAAGG - Intronic
1157465899 18:47944737-47944759 GATCCCAGGAAGCATTGGGAGGG - Intergenic
1157552510 18:48591271-48591293 GGTCCCAGGCTGGCTGTGGATGG + Intronic
1160099168 18:75904401-75904423 GGCCACAGGAGGCAGGTGGAAGG + Intergenic
1160527474 18:79546026-79546048 GAGTCCAGGAAGCATCTGGAAGG - Intergenic
1160833442 19:1113701-1113723 GGTCCTAGGGAGGAGGTGGAGGG + Exonic
1161164594 19:2779446-2779468 GGGTCCAGCAAGCATGAGGACGG + Intronic
1161509360 19:4662057-4662079 GGCCCCAGGAGGCATCAGGAGGG - Intronic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162279491 19:9684042-9684064 GGTCCCAAGAAGCATCTGAAGGG - Intergenic
1163907417 19:20159394-20159416 GGTACCAGGAATAATGTGGGAGG - Intergenic
1164003783 19:21131229-21131251 GGTATCAGGAATAATGTGGAAGG + Intergenic
1164222100 19:23204006-23204028 GGTAGCAGGAAGCTGGTGGAAGG + Intergenic
1164669744 19:30065638-30065660 GGTAGCAGGAGGTATGTGGAGGG + Intergenic
1165174783 19:33920520-33920542 GATCCCAGGAAGAATGTAGATGG + Intergenic
1166914051 19:46182253-46182275 GCTACCAGGAAGCCTGTGGCAGG + Intergenic
1167714929 19:51137145-51137167 TCACTCAGGAAGCATGTGGAAGG - Intergenic
1167747961 19:51363922-51363944 GGTCCAAGGAGGGAAGTGGACGG + Intronic
925089044 2:1138462-1138484 GATGCCAGGAAGCATGTGGTGGG + Intronic
926285351 2:11483093-11483115 GGTCCCGGGAAGGAGGTGGAAGG + Intergenic
926552170 2:14314002-14314024 TGTCCCAGGGAGAATGTGGAAGG - Intergenic
928088617 2:28360637-28360659 GGTTCCAGGAGGCCTGTGGGAGG - Intergenic
929433825 2:41911403-41911425 GTGCCCAGGAGGCATGGGGAAGG - Intergenic
931372837 2:61680110-61680132 GGTACCATCAAGCCTGTGGATGG + Intergenic
932506177 2:72233946-72233968 TGTCCCAGGAAGCACTCGGATGG + Intronic
933809675 2:86025534-86025556 CTGCCCAGGAACCATGTGGATGG + Exonic
934779923 2:96963442-96963464 TGTTGCAGGAAGCATGTGGATGG - Intronic
937648477 2:124294024-124294046 GATCCCAGGATGCATGGGGCTGG + Intronic
937975204 2:127578069-127578091 GGTCCCAGGAGGGAGGTGGTGGG + Intronic
938743198 2:134252283-134252305 CCTCTCAGGAAGCATGTGCAGGG + Intronic
939519660 2:143213770-143213792 GGTCCCAGGAAAAATGAGGACGG - Intronic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
941361491 2:164557260-164557282 GGTGCCAGGCAGCCTGAGGAGGG + Intronic
944427106 2:199594855-199594877 GGTCACAAGAAGCAAGTGGGTGG + Intergenic
944485539 2:200201154-200201176 GATCCCAGCAAGGCTGTGGAAGG - Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946289063 2:218729305-218729327 GGTCCCAGGAAGATTGAGGGAGG + Intronic
1169938542 20:10912064-10912086 GATCCCAGGAAGCATATTGAAGG + Intergenic
1170119447 20:12895652-12895674 GATCCCAGGAGGCACCTGGAGGG - Intergenic
1170420832 20:16191396-16191418 GGTACCAGGAAGCCTGTTCATGG + Intergenic
1170639621 20:18140009-18140031 GGTCACAGGAAGGATGTGTGAGG + Intronic
1171481665 20:25459684-25459706 GGTCCCAGGATGGCTGTGGGGGG - Intronic
1171852045 20:30316009-30316031 GGCCCCAGGCTGCATGTGTATGG + Intergenic
1172215463 20:33232694-33232716 GGCACCAGGAAACAAGTGGAAGG - Intergenic
1172280356 20:33703594-33703616 GGTCCCAGGAAGCACTGGTAGGG + Exonic
1173177838 20:40777860-40777882 GGTCCCAGGAAGCACCAGTAGGG + Intergenic
1173319456 20:41974448-41974470 GATCCTAGGAAGCATGGAGAGGG + Intergenic
1173363880 20:42368063-42368085 GGGCCCAGGAAGCATGGAGGTGG - Intronic
1175064368 20:56272620-56272642 GGGCCCAGGTAGCAGGGGGATGG - Intergenic
1175403601 20:58713882-58713904 GAACCCGGGAAGCGTGTGGACGG - Intronic
1175624481 20:60479014-60479036 GGTGCTGGGATGCATGTGGAGGG - Intergenic
1175687752 20:61043963-61043985 GGCCCCAGGTAGCCAGTGGAAGG + Intergenic
1177320488 21:19513675-19513697 TGTCCCAGGAAGCTTCTGGATGG + Intergenic
1179056399 21:37939209-37939231 GGTGCCGTGAAGCATGGGGAAGG - Intergenic
1179468097 21:41591434-41591456 GCTCATAGGAAGCAAGTGGATGG - Intergenic
1180702502 22:17789301-17789323 GGACCCTGGAATCATGTGGCTGG - Exonic
1180957476 22:19747395-19747417 GGTCCCCTGAAGCATGGGGCTGG - Intergenic
1183238803 22:36640450-36640472 GGTCACAGGAAGCTTGTGGCAGG + Intronic
1183351452 22:37336954-37336976 AGTCCCAGAAAGCATGTCCAAGG + Intergenic
1183590963 22:38779092-38779114 GCTCCCAGGATGCAAGGGGAAGG + Exonic
1183903591 22:41023374-41023396 TGTCCCAGAAAGCATGGGCACGG - Intergenic
1184242770 22:43220155-43220177 GGTCCCAGCAGGAGTGTGGAGGG + Intronic
1185379735 22:50502909-50502931 TTTCCCAGGAGGCATGAGGATGG - Intergenic
949705102 3:6807521-6807543 GGTCCCAGGAAACATTTAAAAGG - Intronic
949859058 3:8489062-8489084 AGTCCCAGAAAGCATGAGAAAGG - Intergenic
950537632 3:13589267-13589289 GCTCCCTGGAAGGCTGTGGAAGG + Intronic
952663224 3:35876183-35876205 GGTATCAGGAATAATGTGGAAGG + Intergenic
952957155 3:38564564-38564586 TTTCCCATGAAGCATGCGGATGG + Intronic
953080029 3:39608324-39608346 TATCCCAGGAAGCATCTGGATGG - Intergenic
953578325 3:44130667-44130689 GCTCCCAGGAAGCCTGTTAATGG - Intergenic
954326553 3:49867251-49867273 GGTCCCCTGAAGCAATTGGATGG - Intronic
954535061 3:51353751-51353773 TGTCCCAGGAAGCATATGGCTGG + Intronic
954535144 3:51354325-51354347 TGTCCCGGGAAGCATATGGCTGG + Intronic
955032717 3:55236801-55236823 GGTCCCAGGAAACAGGTAGGAGG + Intergenic
955217621 3:56997386-56997408 GGGCCCAGGGATCAGGTGGAGGG + Intronic
955330305 3:58041759-58041781 GGTTCCAGGAAGGATTTGTAAGG - Intronic
957715606 3:83926484-83926506 GGTCTCAGGAAGCTTGTAAATGG - Intergenic
957734649 3:84189810-84189832 GGTCTCTGGAATAATGTGGAAGG + Intergenic
958610348 3:96416693-96416715 TGTCCCAGGAAGCACCTAGATGG - Intergenic
959943595 3:112104859-112104881 TGCCCCAGGAAGCAGGTGGAAGG - Intronic
960503745 3:118468142-118468164 GGTCAAAGGAAATATGTGGAAGG + Intergenic
960568089 3:119156490-119156512 TCTCCCAGGAAGCACCTGGATGG - Intronic
964714082 3:159703660-159703682 CATACCAGCAAGCATGTGGATGG + Intronic
966339944 3:178914533-178914555 GTGCCCTGGAAGCATGAGGAAGG - Intergenic
968901457 4:3433850-3433872 GGTCCCGGGAGGCATGTGGGTGG + Intronic
969129276 4:4979594-4979616 GATCCCAGGAAGCAGGAGTAAGG - Intergenic
971143292 4:23948177-23948199 GGTCCCAGGAACCATGTGGTTGG + Intergenic
972302178 4:37794881-37794903 GGTCCCAACAATCATGTGCATGG - Intergenic
972431083 4:38982961-38982983 GGTGCCAGGAAGCAGGGAGAGGG - Intronic
972697784 4:41464803-41464825 GGTTTGAGGAAGCTTGTGGAGGG - Intronic
972733226 4:41815292-41815314 GGTCCCAGGAAACAGGAGGGTGG + Intergenic
973980654 4:56305739-56305761 GTCCCCAGGGGGCATGTGGAGGG + Intronic
977792317 4:101122057-101122079 CTTCCCAGGAAACATGTGCAGGG - Intronic
979357825 4:119726237-119726259 GGAACCAGGAAGCACGTTGAAGG - Intergenic
980206499 4:129725579-129725601 GGTATGAGGAAGGATGTGGAAGG - Intergenic
980455630 4:133038566-133038588 GATACTAGGAAGGATGTGGAGGG - Intergenic
980701828 4:136442121-136442143 GCTGCCAGGAGGCATGGGGAGGG + Intergenic
981561299 4:146051155-146051177 GCTCCCAGAAAGCTTGTGAAGGG + Intergenic
984348791 4:178565541-178565563 AGTCCCAGGGAAAATGTGGAAGG + Intergenic
984607825 4:181805295-181805317 AGTCCCAAGCAGCACGTGGACGG - Intergenic
985912520 5:2895476-2895498 GGTCTCAGGATGGTTGTGGAGGG + Intergenic
987583542 5:19825190-19825212 TGTCCCAGGAAGCATCCAGATGG + Intronic
988658836 5:33242136-33242158 GGTCCCAGGCAGCGTGCAGAAGG - Intergenic
989170347 5:38466832-38466854 AGTGTCAGGGAGCATGTGGAAGG - Intergenic
989232261 5:39100007-39100029 GGTCCCCTGAGGCATGTGGGAGG + Intergenic
990613817 5:57486908-57486930 AGTTCCAGGATGCATTTGGAAGG + Intergenic
992405744 5:76455967-76455989 AGTTCCAGGAATGATGTGGAAGG + Intronic
996158772 5:120136206-120136228 GATCCCAGGAAGCATGGTGAGGG - Intergenic
996464483 5:123783438-123783460 GGTCCCAGGGCACAAGTGGAAGG + Intergenic
997603593 5:135156953-135156975 CGCCCCAGGAAGAAGGTGGAGGG + Intronic
997786642 5:136719513-136719535 GGTCCCAGGCAGCTGGGGGAGGG + Intergenic
997822545 5:137078990-137079012 GGTCACAGTAAGCATGTGTTTGG - Intronic
998053933 5:139057651-139057673 GATCCCAGGAAGTATGGGCAGGG + Intronic
998093468 5:139384007-139384029 GGTCCCAGAAATTATGTGGCTGG - Intronic
998109014 5:139486849-139486871 GGGGCAAGTAAGCATGTGGAGGG + Intergenic
999085612 5:148886173-148886195 AAGCCCAGGCAGCATGTGGACGG + Intergenic
999860790 5:155643503-155643525 GGTCCCAGGAAGCACTAGTAAGG - Intergenic
1001454905 5:171853024-171853046 TGTCCCAGAAATCATGTGGTGGG + Intergenic
1002043205 5:176528947-176528969 GGGCCCAGGGAGGATGGGGAGGG - Exonic
1005958889 6:30682811-30682833 GGAGCCAGGAAGCAAGTGCAGGG - Intronic
1006439705 6:34046458-34046480 GATGCCCGGAAGCATGAGGAGGG + Intronic
1007084458 6:39133600-39133622 GGTATCAGGAATAATGTGGAAGG + Intergenic
1011132296 6:84064171-84064193 GATCCCAGGAAGCAAGGGGTGGG + Intronic
1011396660 6:86917375-86917397 GGTCCCAGGGAGTATTTGGGAGG + Intergenic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1013288408 6:108699564-108699586 GGAGCCAGGAAGCAAGTGGGAGG - Intergenic
1013402849 6:109815525-109815547 GGTACCAAGCAGCATGAGGAGGG - Intronic
1014214949 6:118744557-118744579 GGTCACAGGGAGCATATGGTTGG - Intergenic
1014359707 6:120462515-120462537 GGTACCAGGAATAATGTGGGAGG + Intergenic
1014359927 6:120464134-120464156 GGTACCAGGAATAATGTGGGAGG + Intergenic
1016338862 6:143039139-143039161 TGTCCAAGGAAGCATGTATAGGG - Intergenic
1016349900 6:143155779-143155801 GGTCCCTGGAAGAAACTGGAAGG + Intronic
1017407589 6:154136593-154136615 GGGCCCAGGAACCAAGCGGAGGG - Intronic
1017874267 6:158511895-158511917 AGACCCAGGAAGCAACTGGAGGG - Intergenic
1018462165 6:164008741-164008763 GGTCACAGAGAGCAAGTGGAGGG + Intergenic
1018811391 6:167300687-167300709 GGTCCCTGGGACCATGTTGATGG - Intronic
1019031576 6:169018339-169018361 TGTCTGAGGAAGCATCTGGATGG - Intergenic
1019257712 7:62385-62407 GGTCCCAGAAAGGAGCTGGAGGG - Intergenic
1019541647 7:1554398-1554420 GAGCCCAGGAAGGCTGTGGAGGG - Intronic
1019994817 7:4717282-4717304 GGTAGCAGGAGGCGTGTGGATGG + Intronic
1023331222 7:39119121-39119143 GGACCCAGGAAAGAGGTGGAGGG + Intronic
1023883679 7:44335672-44335694 GATCCCTGGGAGCTTGTGGAGGG - Intergenic
1024086264 7:45894259-45894281 GGTGCTAGGAAAGATGTGGAGGG - Intergenic
1028142985 7:87291930-87291952 TGTCCCAGGAAGCACCTAGATGG + Intergenic
1029129228 7:98317604-98317626 GGTCCCAGCCAGCATGCAGACGG - Intronic
1029129236 7:98317645-98317667 GGTCCCAGCCAGTGTGTGGATGG - Intronic
1029129279 7:98317886-98317908 GGTCCCAGCCAGCATGCAGATGG - Intronic
1029129312 7:98318047-98318069 GGTCCCAGCCAGCATGCAGATGG - Intronic
1029151479 7:98483680-98483702 GATCCCAGGAAGCATTTTCAGGG - Intergenic
1029906499 7:104098630-104098652 GAGCACAGGAAGCAGGTGGAAGG + Intergenic
1030111569 7:106031212-106031234 GCATCCAGGAAGAATGTGGATGG - Intronic
1030130219 7:106193599-106193621 GGTCCCAGGAAGCAGGAGGATGG + Intergenic
1030567297 7:111174689-111174711 AGTCCCATAAAGCATGTGCATGG + Intronic
1033610520 7:142960016-142960038 CGTCCCAGGAAGTTGGTGGATGG - Intronic
1034451387 7:151138933-151138955 GAGCCCTGGAAGCAGGTGGAAGG - Intronic
1034975836 7:155448920-155448942 CGTCCCATGAAGCACGGGGAAGG - Intergenic
1035034307 7:155885210-155885232 TGTCCCAGGAAGAATGCAGATGG + Intergenic
1035366177 7:158350343-158350365 GTTCCCAGGAAACATGTACAGGG + Intronic
1037361682 8:18081137-18081159 CGTTCCAGGAAACATGGGGAGGG - Intronic
1038821575 8:30956998-30957020 TATCCCAGGAAGCATGTTGAGGG + Intergenic
1039495682 8:37978384-37978406 GGTTCCAGGAAGCCTGTGGTGGG - Intergenic
1042673439 8:71289124-71289146 GGTCCCTGGAAGGAAGGGGAGGG + Intronic
1044547100 8:93472051-93472073 GATGCCAGGAACCATGGGGAGGG + Intergenic
1045676644 8:104614897-104614919 TATCCCAAGAAGCATCTGGATGG - Intronic
1047200024 8:122757303-122757325 GGTCCCAGGAAGCCAGGGCAAGG - Intergenic
1049182697 8:141231160-141231182 GGTCCCAGGATGGGTGCGGAGGG + Intronic
1049417271 8:142500806-142500828 GGTGCCTGGAAGCAGGGGGATGG + Intronic
1049720214 8:144112159-144112181 GGGCCCAGCAGGCATGTGGGAGG - Intronic
1049745134 8:144260082-144260104 GGTCCCAGGCAGCATGGGTGGGG + Intronic
1050979576 9:11992955-11992977 AATCCCAGGAAGCATGAGTAAGG + Intergenic
1051891345 9:21945483-21945505 TGTCCCAGGAAGTATCTGGATGG + Intronic
1053789827 9:41679265-41679287 GGCCCCAGGCTGCATGTGTATGG + Intergenic
1054155313 9:61635491-61635513 GGCCCCAGGCTGCATGTGTATGG - Intergenic
1054178167 9:61890955-61890977 GGCCCCAGGCTGCATGTGTATGG + Intergenic
1054659362 9:67689869-67689891 GGCCCCAGGCTGCATGTGTATGG - Intergenic
1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG + Intergenic
1057975137 9:99597719-99597741 AGTCCCAGGAGACATGAGGAAGG + Intergenic
1058773936 9:108265657-108265679 GCTCCCAGGAAGGCTATGGATGG - Intergenic
1058917978 9:109585996-109586018 GGAGCCTGGCAGCATGTGGAAGG + Intergenic
1059760929 9:117336738-117336760 AGTCTGAGGAATCATGTGGATGG - Intronic
1061191550 9:129085425-129085447 GTACCCAGGGAGCATTTGGATGG + Intronic
1062236072 9:135508385-135508407 GATCCCAGGAAGCCTGAGGGAGG + Intergenic
1062407366 9:136403292-136403314 GGTCCCAGGGAGCAAGGGGTGGG + Intronic
1062407404 9:136403387-136403409 GGTCCCAGGGAGCAAGGGGTGGG + Intronic
1062623608 9:137433445-137433467 GGACCCAGGGAGCAGGTGCAGGG + Exonic
1185513888 X:683895-683917 GGTAGCAGGAAGCATGTTGGAGG - Intergenic
1186843924 X:13512283-13512305 GGTCCCAGGAAGCATCCAGGAGG - Intergenic
1187308507 X:18118916-18118938 GATCCCAAGAAGCATGGCGAGGG - Intergenic
1187765215 X:22634130-22634152 GATTCCAGGAAGCCTGTGGCTGG + Intergenic
1188509550 X:30920631-30920653 GGTCCCAGGAAGCACATGTGAGG - Intronic
1189579291 X:42388897-42388919 GATCCCAGGAAGCATTGTGAGGG + Intergenic
1189873013 X:45404359-45404381 TGTCCCAAGAAGCACCTGGATGG + Intergenic
1190936979 X:55006532-55006554 GGACCCAGGGCGCAAGTGGATGG + Exonic
1192007486 X:67232729-67232751 AGTCCCAGGAAGAATGTGAGGGG + Intergenic
1193406646 X:81108839-81108861 TGTCCCAGGAAGCATTTGAATGG - Intergenic
1194267899 X:91778309-91778331 GGTACCAGGAGGAATGTGGCTGG - Intergenic
1195283590 X:103360355-103360377 GCACTCAGGAAGGATGTGGAAGG + Intergenic
1199263219 X:145800001-145800023 GGTATGAGCAAGCATGTGGAGGG - Intergenic
1199746672 X:150776072-150776094 GGTCTCAGGCAGGCTGTGGAGGG + Intronic
1199779661 X:151046574-151046596 GCTGCCAGGAAGTTTGTGGAAGG - Intergenic
1200585105 Y:4999234-4999256 GGTACCAGGAGGAATGTGGCTGG - Intergenic