ID: 1104492826

View in Genome Browser
Species Human (GRCh38)
Location 12:129209382-129209404
Sequence CAGGATAACCAGAATGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104492819_1104492826 4 Left 1104492819 12:129209355-129209377 CCACGGAGAATGTCCTGATTTAA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 166
1104492818_1104492826 16 Left 1104492818 12:129209343-129209365 CCAATATTTGTGCCACGGAGAAT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 166
1104492822_1104492826 -9 Left 1104492822 12:129209368-129209390 CCTGATTTAAGTGGCAGGATAAC 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104492826 Original CRISPR CAGGATAACCAGAATGGGAT GGG Intronic
903222276 1:21875590-21875612 CAGGAGGACCAGCATGGGCTTGG - Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903862739 1:26374703-26374725 CATGATCACCAGAGTGGGTTTGG + Intergenic
907087978 1:51695608-51695630 CAGCGAAAACAGAATGGGATGGG + Intronic
910267773 1:85357769-85357791 CAGTATAACCAGAATGAATTTGG + Intronic
911902395 1:103522934-103522956 CTGGAAAACCAGAGTGGAATAGG + Intergenic
913149539 1:116026971-116026993 CAGGTTAACCAGAATGGCTAGGG - Exonic
914866288 1:151432246-151432268 CAAAATCACCAGAATGGGATGGG + Intronic
918657964 1:187052857-187052879 GAGGAGAAAAAGAATGGGATGGG - Intergenic
924829161 1:247574140-247574162 CAGGAAAACGAGAATGGCAGTGG + Exonic
924838155 1:247676416-247676438 AAGAATAACCAGATTGGGTTAGG + Intergenic
1063023842 10:2157875-2157897 TAGGATAATCAGAATGGGTTTGG + Intergenic
1063696495 10:8340510-8340532 TAGAAGAACCAGGATGGGATGGG - Intergenic
1064832115 10:19480553-19480575 CAGTAAATCCAGAATGGGAGGGG + Intronic
1073250259 10:102116991-102117013 CAGGATGACCAGGGTGGGCTGGG + Intronic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1082093172 11:48105947-48105969 AAGGAAAACCAGTAAGGGATGGG - Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1084920966 11:72469303-72469325 CAGGGGAACTTGAATGGGATGGG - Intergenic
1086651834 11:89301257-89301279 CAGTATCACGAGAATAGGATGGG + Intergenic
1086944128 11:92828469-92828491 AAGCATAACCAGAAAGGGGTGGG - Intronic
1087407539 11:97748587-97748609 CATCATAACCAGTATGTGATGGG + Intergenic
1089115753 11:116093735-116093757 CAGCATAGCCAGACTGGGAAAGG - Intergenic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1092124762 12:6067155-6067177 CAGCACATCCAGAATGGGCTGGG - Intronic
1092836533 12:12494511-12494533 CAGGATAAACAAAATGGCAGTGG + Intronic
1093360528 12:18221192-18221214 TATGATAACCAGACTTGGATAGG - Intronic
1095437651 12:42208857-42208879 CTAGATAAACAGAATGGAATTGG + Intronic
1096636674 12:52964826-52964848 GAGCATAACCAGATTGGGACAGG + Intergenic
1096939837 12:55330634-55330656 AAGGATATCCAGAATTGTATAGG - Intergenic
1097576433 12:61399165-61399187 AAGGAGAGCGAGAATGGGATGGG + Intergenic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098617819 12:72552217-72552239 CAGCATACCAAGAAAGGGATTGG + Intronic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG + Intergenic
1106114755 13:26807727-26807749 CAGGATACTCAAAATGGAATGGG - Intergenic
1108957293 13:56175717-56175739 CAGGATAAACAGCTTAGGATTGG + Intergenic
1112797597 13:103073028-103073050 CACTATTACCAGAATAGGATAGG + Intergenic
1116519573 14:45832517-45832539 CATAATAACCAGAATGGGAGAGG - Intergenic
1121030598 14:90655234-90655256 CAGAATCACCAGAGTGGGATTGG - Intronic
1123504578 15:20927558-20927580 CAGGATTACAATAATGTGATAGG + Intergenic
1123561825 15:21501259-21501281 CAGGATTACAATAATGTGATAGG + Intergenic
1123598069 15:21938540-21938562 CAGGATTACAATAATGTGATAGG + Intergenic
1125303263 15:38280352-38280374 CATGATAGCCAGAAGGGTATTGG + Intronic
1126855425 15:52834391-52834413 GAGGATACCCAGGATGGGAAGGG + Intergenic
1202970170 15_KI270727v1_random:228385-228407 CAGGATTACAATAATGTGATAGG + Intergenic
1133517717 16:6525995-6526017 CAAGATATCCAGTATGAGATTGG + Intronic
1134021299 16:10923322-10923344 CAGGGTAACCAGGGTGGGCTTGG + Exonic
1135071600 16:19356973-19356995 GAGGTTAAACAGTATGGGATTGG - Intergenic
1138458081 16:57132704-57132726 CAGGGCAACCAGTATGGGAGGGG + Intronic
1138507261 16:57484593-57484615 CAGGAGAACCAGAGTGGTACGGG - Intronic
1139211651 16:65083569-65083591 CAGGATGGCTAGAATGGGAAAGG - Intronic
1139350135 16:66329733-66329755 CAGGATGACCACAATGGCAGGGG - Intergenic
1140169910 16:72593801-72593823 CAGCATCACCAGAATGCTATTGG - Intergenic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1144201085 17:12943360-12943382 CAGGAGAACCAGACAGGAATAGG - Intronic
1146489158 17:33267759-33267781 CAGGATACCCAGAAGTGGAGGGG + Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1150129087 17:62657132-62657154 AAGGAGAACAAGAAGGGGATGGG + Intronic
1150385249 17:64754029-64754051 CAGGATAACCAGAATAATCTTGG + Intergenic
1150771403 17:68044457-68044479 CAGGATAACCAGAATAATCTTGG - Exonic
1153071235 18:1106861-1106883 CTAGAAAACCAGGATGGGATGGG - Intergenic
1155355828 18:24953073-24953095 CAGCATAAACAGCATGGTATTGG - Intergenic
1155453679 18:25988635-25988657 CAGTATAACCAAAAAGGGAGGGG + Intergenic
1157524630 18:48371569-48371591 CAGGATAACCAGGAAGAGAGTGG + Intronic
1158205673 18:54990153-54990175 CAAGACAAAAAGAATGGGATGGG + Intergenic
1158272085 18:55727387-55727409 GAGGAGAACTGGAATGGGATAGG - Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162145261 19:8609399-8609421 CAGGATCCCCGGGATGGGATGGG - Intronic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1166381021 19:42355473-42355495 CAGGATGACCAGTAGGGGATGGG + Intronic
1166567099 19:43771948-43771970 GAGGATGACCAGTTTGGGATAGG + Intronic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167097767 19:47383920-47383942 CAGGAGTTCCAGACTGGGATGGG + Intergenic
1167126100 19:47549726-47549748 CAGCATGACCACAATGGGCTGGG + Intronic
1167976591 19:53231864-53231886 AAGGAAAACCTGAATGGAATAGG + Intergenic
926286918 2:11495968-11495990 GAGGATAACCAGACTGGGAGAGG + Intergenic
927413587 2:22853892-22853914 CAGGAAAACCAGAATTTGAAAGG - Intergenic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
940148586 2:150574413-150574435 CAGGGTAACAGGAATAGGATGGG + Intergenic
942775732 2:179580357-179580379 CAGGTTGCCCAGAATGGCATAGG + Intronic
945278290 2:208010707-208010729 CAAGATACCCAGAAAGGGCTGGG + Intronic
945326714 2:208490764-208490786 CAGGATTTCCAGGATGGAATGGG + Intronic
947365518 2:229390659-229390681 GATGAAAACCAGAATGAGATAGG - Intronic
1170406340 20:16041976-16041998 TAGGAGAACCAGAATTGGTTAGG + Intronic
1171949229 20:31406067-31406089 CAGGATCTCCAGAAGGGGATGGG - Intronic
1171993734 20:31716546-31716568 CAGAATAACAATAATGGGAGTGG - Intronic
1176307527 21:5131688-5131710 CAGGATGACCCCAAAGGGATGGG - Intronic
1179849533 21:44130342-44130364 CAGGATGACCCCAAAGGGATGGG + Intronic
1181056957 22:20264836-20264858 CAGGCTCACCAGAATGGGGGCGG + Intronic
1181546829 22:23606978-23607000 CAGGCCAACCAGCATGGGAGGGG + Intergenic
1184809559 22:46821853-46821875 CTGGAGTACCAGAAGGGGATGGG - Intronic
953453248 3:43021319-43021341 CAAGATAACCAGGATGGAACAGG - Intronic
954168171 3:48778001-48778023 GAGGATGACCTGAATGGGAAAGG - Intronic
956177130 3:66483648-66483670 CAGAATAACCACAAGGGGAAGGG + Intronic
959809255 3:110595586-110595608 CAGCATAACCAGAATGACCTTGG + Intergenic
960315013 3:116165887-116165909 CAGGATACCCTGGATGGGGTGGG - Intronic
961171235 3:124799252-124799274 AAGGATAACACGAATAGGATGGG + Intronic
967472852 3:189883067-189883089 CAAGAAAACCAGAATGGTACAGG + Intronic
970494455 4:16610739-16610761 CTGGAGTACCAGAATGTGATGGG + Intronic
975542756 4:75531827-75531849 CACTATTACCAGAATGGCATAGG + Intronic
975578024 4:75882134-75882156 CAAAATAACCAGAATGTGTTGGG - Intronic
975974633 4:80080833-80080855 CAGGATAACCAGAATAACCTTGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977604403 4:98967930-98967952 CTGAATCACCAGAATGGTATAGG - Intergenic
977892362 4:102326849-102326871 TAGGATAACCAGGATGAGAAGGG - Intronic
978332831 4:107633614-107633636 CAGCGTAAAAAGAATGGGATTGG + Intronic
979772718 4:124548900-124548922 GAAAATAACCTGAATGGGATAGG + Intergenic
980256199 4:130383203-130383225 CACTATCACCAGAATGGCATGGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982395433 4:154910610-154910632 CAGCATAATCTGAAAGGGATAGG + Intergenic
983049766 4:163032621-163032643 CAGGCTATTCAGAAAGGGATAGG + Intergenic
986670979 5:10142350-10142372 CAGTATCACAAGAATGGCATGGG - Intergenic
986847672 5:11774959-11774981 AAGGACAACTAGGATGGGATTGG - Intronic
986847981 5:11778215-11778237 AAGGACAACTAGGATGGGATTGG - Intronic
987025296 5:13920893-13920915 AAGTATTACCAAAATGGGATGGG - Intronic
987694686 5:21312442-21312464 CATAATAACCTGGATGGGATTGG - Intergenic
988600268 5:32633113-32633135 CAGGAGGGACAGAATGGGATTGG + Intergenic
988993180 5:36690745-36690767 CAGGATACCCAGAAAGGAAGGGG - Intergenic
991745549 5:69737031-69737053 CATAATAACCTGGATGGGATTGG + Intergenic
991752157 5:69818202-69818224 CATAATAACCTGGATGGGATTGG - Intergenic
991797116 5:70316784-70316806 CATAATAACCTGGATGGGATTGG + Intergenic
991824927 5:70612345-70612367 CATAATAACCTGGATGGGATTGG + Intergenic
991831477 5:70693307-70693329 CATAATAACCTGGATGGGATTGG - Intergenic
991889495 5:71316317-71316339 CATAATAACCTGGATGGGATTGG + Intergenic
996657352 5:125957229-125957251 CAGGATAACTAGAGTGGTATTGG - Intergenic
1003346882 6:5277889-5277911 CAGGATACCCAAAATGGACTGGG - Intronic
1004166576 6:13262092-13262114 GAGGAGGACCAGAGTGGGATAGG + Intronic
1005104044 6:22203999-22204021 TAGTTTAACCAGAATGGGCTTGG - Intergenic
1005556216 6:26987496-26987518 CATAATAACCTGGATGGGATTGG + Intergenic
1011151100 6:84274194-84274216 AAAGAGAACGAGAATGGGATTGG + Intergenic
1011648626 6:89484716-89484738 CAGAATACCCATAATGAGATTGG + Intronic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1021466794 7:20953079-20953101 AAGGATAACCAGGAAGGGAAGGG + Intergenic
1021543824 7:21790674-21790696 CAGGATAACTAGGATGGGAAAGG + Intronic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1028253574 7:88564991-88565013 CAGGATAACCAGAATAAACTTGG + Intergenic
1028896812 7:96050605-96050627 CAAGATAAACCGAATGGGAAAGG - Intronic
1029547954 7:101221133-101221155 CAGGAGAAGCAGACTTGGATGGG + Intronic
1030771648 7:113483165-113483187 AAGGATGAACAGAATGGGAGAGG - Intergenic
1033823696 7:145163672-145163694 CAGAATAACAAGAAAGGAATAGG - Intergenic
1034261259 7:149757580-149757602 CAGAATAACCAGACTGGGGCGGG + Intergenic
1036090501 8:5660144-5660166 CAGGATAGCCACAAAGTGATGGG + Intergenic
1036598382 8:10236281-10236303 CAGGAGAATAAGAATGGGAGAGG + Intronic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037512568 8:19598699-19598721 CTGGATCACCAAAATGGGAAAGG + Intronic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1041252228 8:55945790-55945812 CAAGAAAACCTGGATGGGATGGG + Intronic
1041310329 8:56510139-56510161 CAGGATACCCAGACTAGGACAGG - Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1041819600 8:62015794-62015816 CAGCATAACCAGGCTGGGAGGGG - Intergenic
1042687678 8:71460824-71460846 CAGGATCACCAGAATTGCCTGGG - Intronic
1043817595 8:84821590-84821612 CTGGATGAACAGAATGTGATTGG - Intronic
1045121618 8:99043816-99043838 CAACATAACCATAAAGGGATTGG - Intronic
1045316200 8:101045819-101045841 CAGGGTGAGTAGAATGGGATAGG + Intergenic
1049506612 8:143004354-143004376 CTGGAAAACCAGCATGAGATAGG - Intergenic
1050052920 9:1622175-1622197 CAGTATCACAAGAATGGCATGGG + Intergenic
1052011849 9:23420233-23420255 CAGGGAAACCAGAATGGAAGGGG - Intergenic
1058152046 9:101474156-101474178 CAGCATAGCCAAAATGGGAACGG - Exonic
1058395752 9:104552040-104552062 AGGGATAACCAAAGTGGGATAGG + Intergenic
1058650323 9:107169832-107169854 CAGGATAACCAGAATAACCTTGG + Intergenic
1059422381 9:114200256-114200278 CAGGAGACACAGGATGGGATAGG - Intronic
1187227345 X:17386301-17386323 GAGGACAACCAGAGTGGGAATGG - Intronic
1187279328 X:17845979-17846001 TGGGATAACAAGAATGGCATAGG + Intronic
1187443712 X:19343047-19343069 CAGGCTAACTAGAATTGGCTGGG - Intergenic
1191741485 X:64439866-64439888 CAGGAAAACCAAATTTGGATAGG + Intergenic
1193155935 X:78174326-78174348 CTGGATAACAGGAATGGGAATGG - Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1196706487 X:118721732-118721754 AAGGATGACCAGAATGAGAGAGG - Intergenic
1196866010 X:120071995-120072017 CAGCAAAACCAAAATGGTATCGG - Intergenic
1196877086 X:120164286-120164308 CAGCAAAACCAAAATGGTATCGG + Intergenic
1201434280 Y:13939904-13939926 CAGGAATACCAGAGTGGGAGGGG - Intergenic
1201966172 Y:19738864-19738886 CAGGATAAGAAGTATGGGATTGG - Intronic