ID: 1104493910

View in Genome Browser
Species Human (GRCh38)
Location 12:129218982-129219004
Sequence CTGGGGTTACAGGTTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104493901_1104493910 15 Left 1104493901 12:129218944-129218966 CCCAGAATTGTCTGACTAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1104493910 12:129218982-129219004 CTGGGGTTACAGGTTTCCCCGGG 0: 1
1: 1
2: 6
3: 29
4: 246
1104493902_1104493910 14 Left 1104493902 12:129218945-129218967 CCAGAATTGTCTGACTAAAGGCT 0: 1
1: 0
2: 2
3: 11
4: 101
Right 1104493910 12:129218982-129219004 CTGGGGTTACAGGTTTCCCCGGG 0: 1
1: 1
2: 6
3: 29
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104493910 Original CRISPR CTGGGGTTACAGGTTTCCCC GGG Intronic