ID: 1104493910 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:129218982-129219004 |
Sequence | CTGGGGTTACAGGTTTCCCC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 283 | |||
Summary | {0: 1, 1: 1, 2: 6, 3: 29, 4: 246} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104493901_1104493910 | 15 | Left | 1104493901 | 12:129218944-129218966 | CCCAGAATTGTCTGACTAAAGGC | 0: 1 1: 0 2: 1 3: 5 4: 110 |
||
Right | 1104493910 | 12:129218982-129219004 | CTGGGGTTACAGGTTTCCCCGGG | 0: 1 1: 1 2: 6 3: 29 4: 246 |
||||
1104493902_1104493910 | 14 | Left | 1104493902 | 12:129218945-129218967 | CCAGAATTGTCTGACTAAAGGCT | 0: 1 1: 0 2: 2 3: 11 4: 101 |
||
Right | 1104493910 | 12:129218982-129219004 | CTGGGGTTACAGGTTTCCCCGGG | 0: 1 1: 1 2: 6 3: 29 4: 246 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104493910 | Original CRISPR | CTGGGGTTACAGGTTTCCCC GGG | Intronic | ||