ID: 1104494779

View in Genome Browser
Species Human (GRCh38)
Location 12:129226659-129226681
Sequence CACCTACCAATATTGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104494779_1104494780 1 Left 1104494779 12:129226659-129226681 CCAAGAAACAATATTGGTAGGTG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1104494780 12:129226683-129226705 GATCTCCTAACTTTTACATTTGG 0: 1
1: 1
2: 1
3: 19
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104494779 Original CRISPR CACCTACCAATATTGTTTCT TGG (reversed) Intronic
906811403 1:48830737-48830759 CACCTAGCAATTTTGCTTTTGGG + Intronic
908550273 1:65201780-65201802 CACCTTCCAATTATGGTTCTGGG - Intronic
909562407 1:77021292-77021314 CCCCAACCAATTTGGTTTCTTGG - Intronic
909750756 1:79157635-79157657 CACCCACCAATCTCGTTACTGGG - Intergenic
909968920 1:81956045-81956067 CACTTACCAATATTTTCTGTGGG - Exonic
912543742 1:110436251-110436273 CACCCCCCAAAATTGTTTCATGG - Intergenic
914839789 1:151238930-151238952 CAGAGACCAATGTTGTTTCTAGG - Intronic
919393793 1:197020478-197020500 GATCTACGAATATTGTTTCAAGG - Intergenic
919900024 1:202037373-202037395 CTCCTACCACTATGGTCTCTAGG - Intergenic
920568844 1:207000912-207000934 CACCTACCACCATTGCTTGTAGG - Intergenic
920970597 1:210740457-210740479 TACCTAACTCTATTGTTTCTGGG + Intronic
924505084 1:244674873-244674895 GACCTAGCAATTTTATTTCTAGG - Intronic
1063853482 10:10220490-10220512 CACCTGGCAATACTGTTTCCTGG + Intergenic
1064516761 10:16158105-16158127 CATTTACCCATATTGTTGCTTGG - Intergenic
1064548489 10:16475124-16475146 CACCTGCTAATACTGTTACTGGG + Intronic
1064885574 10:20108308-20108330 CACATACCAATTTTCCTTCTTGG + Intronic
1066311367 10:34199996-34200018 CACTTACCAATCATGTTTCATGG - Intronic
1074021461 10:109588779-109588801 CAGCCACCATTATTGGTTCTTGG + Intergenic
1074676157 10:115853722-115853744 CAAATACAAATATTGTTTATAGG + Intronic
1075698882 10:124455676-124455698 CTCCTTCCCACATTGTTTCTGGG + Intergenic
1080673411 11:34401969-34401991 CATTGGCCAATATTGTTTCTTGG + Intergenic
1081025144 11:38003224-38003246 CACCTACCAATCTTGGGTTTGGG - Intergenic
1087879477 11:103398655-103398677 CACTTTCCAAAATTATTTCTTGG + Intronic
1088721424 11:112595444-112595466 CACCTACTGATATTGTTTGATGG + Intergenic
1089929724 11:122298043-122298065 CCTCTACCATTATTGTATCTGGG - Intergenic
1090339541 11:126004618-126004640 CTCCATGCAATATTGTTTCTTGG - Intronic
1091401559 12:184014-184036 TACCAACCAATCTTGTTTATGGG + Intergenic
1092052745 12:5484056-5484078 CACCTACCAATAGGGTTTCCTGG - Intronic
1092787327 12:12039162-12039184 CAACTACCAAAAATGTTTCCAGG + Intergenic
1095766893 12:45905760-45905782 AACCTACCAATAATGCTTCTAGG - Exonic
1096691841 12:53326118-53326140 CACAAAACAAAATTGTTTCTCGG - Intergenic
1097384711 12:58936108-58936130 CACCTAATAATATAGTCTCTGGG + Intergenic
1104494779 12:129226659-129226681 CACCTACCAATATTGTTTCTTGG - Intronic
1107690238 13:42946423-42946445 CAATTTCCAACATTGTTTCTAGG - Intronic
1108404706 13:50088673-50088695 CACGTACCAATAATGATTCCTGG + Intronic
1110148171 13:72219847-72219869 CACCTACCAAGATTGAATCAAGG - Intergenic
1111433409 13:88174364-88174386 CACCGAGCAATTTTGTTACTGGG + Intergenic
1112985898 13:105449457-105449479 CACCTGCCAACATATTTTCTTGG + Intergenic
1115928193 14:38461143-38461165 TACATACCACTATTGTTTGTAGG + Intergenic
1116212919 14:41971014-41971036 CACATACAAATATTGTTTATTGG - Intergenic
1119947684 14:78712311-78712333 TACCTCCCAATATTGTTTTGAGG + Intronic
1121445987 14:93979388-93979410 GACCTGCCCATATTGTTTCATGG + Intergenic
1121565467 14:94906328-94906350 GACCAACCAGTTTTGTTTCTGGG - Intergenic
1123803272 15:23844220-23844242 CAACTACCAATATACTTTATAGG + Intergenic
1134158974 16:11868976-11868998 CAGCTAGCATTATTGTTTCAAGG + Exonic
1135840259 16:25869702-25869724 CACCTACTGATAGAGTTTCTGGG - Intronic
1137563057 16:49515322-49515344 CAACTACTAAAATAGTTTCTGGG + Intronic
1137663582 16:50232865-50232887 CACTAACCAAGAATGTTTCTAGG + Intronic
1139184723 16:64792253-64792275 CACAAACCAACATTGTTTCTGGG + Intergenic
1139377227 16:66507490-66507512 CACCAACCTATTTTGTCTCTGGG + Intronic
1143298592 17:5891115-5891137 CCCCTGCCAGTCTTGTTTCTGGG + Intronic
1145930513 17:28682035-28682057 TACCTACCAGTCTTTTTTCTGGG - Intronic
1149155673 17:53627000-53627022 TACCTAACAATAAAGTTTCTGGG - Intergenic
1149805424 17:59613031-59613053 CACCTATTAATATTATTACTTGG + Intergenic
1152460956 17:80442152-80442174 AACTTGCCAATCTTGTTTCTGGG + Intergenic
1158890195 18:61865212-61865234 TACCTACCAATAATCATTCTGGG + Intronic
1159437341 18:68436059-68436081 CACCTATTAATATTATTCCTGGG + Intergenic
1164434370 19:28216543-28216565 CACTGACCATTATTTTTTCTTGG - Intergenic
926459685 2:13113327-13113349 CACCTACAAATATGTTTTATGGG - Intergenic
928261826 2:29774844-29774866 CAGCTACTAATTTTTTTTCTTGG - Intronic
930961220 2:57264244-57264266 GACCTAGCAATCTTGTTACTGGG + Intergenic
932507104 2:72245524-72245546 CACTTACCAATATGCTTTCAAGG - Intronic
935084145 2:99828046-99828068 CACCTTACAAAATTGGTTCTTGG + Intronic
935574260 2:104692576-104692598 CAAGCACCAAAATTGTTTCTAGG + Intergenic
936850029 2:116884913-116884935 CATCTACCAGTATTGTTTAAAGG - Intergenic
941151165 2:161917430-161917452 AACCTAGCAATCTTGTTTCTAGG - Intronic
942577376 2:177378501-177378523 CACCCACCAAAGTTGTTCCTGGG + Intronic
944126951 2:196304965-196304987 CTCCTGCCCATCTTGTTTCTGGG + Intronic
1170893347 20:20394191-20394213 GACCTTCCCTTATTGTTTCTAGG + Intronic
1177807408 21:25887773-25887795 CACCTACAACTATTGCTCCTAGG - Intronic
1177811146 21:25926023-25926045 CCCCTGGCAGTATTGTTTCTTGG - Intronic
1182561405 22:31162478-31162500 CACATACCATTATTCTTTCTTGG + Intronic
949459427 3:4274298-4274320 CCCCTACAAATTTAGTTTCTTGG - Intronic
953521016 3:43643355-43643377 CACCCAGCAATCTCGTTTCTAGG - Intronic
957331754 3:78774005-78774027 CATCTCCCAAGATTGTTTCATGG - Intronic
957497839 3:81013270-81013292 AAGTTTCCAATATTGTTTCTGGG + Intergenic
959195031 3:103169263-103169285 CACCTAGCAATCTTTCTTCTGGG + Intergenic
959234386 3:103700134-103700156 CAACTACAAATATTTTTTATAGG + Intergenic
967021149 3:185524068-185524090 TACCTCCCAATATTGTTTTGGGG + Exonic
967722703 3:192832254-192832276 CACTTACTGATATTTTTTCTTGG + Intronic
969931299 4:10633591-10633613 CACCTACGAGCATTGGTTCTAGG - Intronic
969949363 4:10818521-10818543 TAACTACCAATATTAATTCTGGG - Intergenic
970079821 4:12269479-12269501 CACTTACTAAGATTGCTTCTAGG + Intergenic
971971575 4:33627192-33627214 CACCTACTAATGTGATTTCTAGG - Intergenic
972190740 4:36587710-36587732 CCTGTACCAATATTGTATCTAGG + Intergenic
972338042 4:38126092-38126114 CACCTACACATGTTGTTCCTAGG + Intronic
973727768 4:53792827-53792849 CACCTCCCATTATAGTTCCTTGG + Intronic
976714404 4:88108091-88108113 CAAACACCAATCTTGTTTCTAGG + Intronic
976951301 4:90835007-90835029 CATCTACCAACATTTATTCTTGG + Intronic
979827238 4:125253973-125253995 CATCTACCAATCTTTTTACTTGG + Intergenic
980235260 4:130097295-130097317 CACCTTTCAAAATTCTTTCTGGG + Intergenic
986825126 5:11512090-11512112 CCCCAACCAATATAGCTTCTTGG + Intronic
987041850 5:14070074-14070096 CACCTTCCAATAGTGTTTGCTGG - Intergenic
990272406 5:54157710-54157732 CCCCTAACAATATTATTTATAGG + Intronic
995836736 5:116406929-116406951 CACCTATCATTATTGTTAATGGG - Intronic
996156261 5:120106307-120106329 CACCTCCAAAAATTGTCTCTAGG + Intergenic
998502465 5:142645401-142645423 CACCTTCCAATATTGACTCAGGG - Intronic
999835988 5:155373389-155373411 CAAATACCTATATTTTTTCTAGG + Intergenic
1000569312 5:162892397-162892419 AATCTAGCAATAATGTTTCTAGG - Intergenic
1001299281 5:170522364-170522386 CACATTACAATAATGTTTCTTGG - Intronic
1001359786 5:171071019-171071041 CACCCAGCAATTTTATTTCTAGG - Intronic
1001903091 5:175446927-175446949 CTCCTACCTATTTTATTTCTGGG - Intergenic
1002435708 5:179229569-179229591 CCCCTACAAAGAGTGTTTCTTGG - Intronic
1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG + Intergenic
1007196680 6:40067305-40067327 CATCTACCCATATTCCTTCTAGG - Intergenic
1009052899 6:58299557-58299579 CACCTTACAATATTATTACTAGG + Intergenic
1009238213 6:61151029-61151051 CACCTTACAATATTATTACTAGG - Intergenic
1010185138 6:73135091-73135113 CACCTACCAATTCTATTTCTAGG + Intronic
1011731511 6:90269223-90269245 CACCTACCAATATTCTATGCTGG + Intronic
1014988210 6:128039086-128039108 GACCTGACAATATTGCTTCTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1021001031 7:15330631-15330653 CAACTACACATATTTTTTCTGGG + Intronic
1021122349 7:16810741-16810763 CATCTAACAATATTGACTCTAGG - Intronic
1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG + Intergenic
1023298459 7:38741195-38741217 TACCTGCAAAAATTGTTTCTAGG + Intronic
1024317000 7:48029722-48029744 CACCTAACTATTCTGTTTCTAGG - Intergenic
1032502810 7:132412753-132412775 CACCTACAAGAATTGTGTCTTGG - Intronic
1033113996 7:138609294-138609316 CACCTACCAATCCAATTTCTAGG + Intronic
1033497594 7:141915460-141915482 GACCTACCAATTCTATTTCTAGG - Intronic
1033600147 7:142883515-142883537 CACCTTCCATTATTGTTACCGGG + Intronic
1035699811 8:1630203-1630225 CACCTACTACGTTTGTTTCTGGG - Intronic
1037040446 8:14224790-14224812 CACCACCTAATATTCTTTCTTGG + Intronic
1037259322 8:16989593-16989615 CACCTACCAACTTGTTTTCTAGG - Intergenic
1043513432 8:80973142-80973164 AAGCTACCACTATTCTTTCTGGG - Exonic
1044997165 8:97848480-97848502 CACCCACCATTTTTTTTTCTAGG - Intronic
1045108572 8:98917965-98917987 CACTTACCTTTATTGTTACTAGG - Intronic
1045702752 8:104885750-104885772 CACCCACCAATAATAATTCTGGG - Intronic
1045899789 8:107263527-107263549 CACTTACCAATGATGCTTCTTGG - Intronic
1046497418 8:115033474-115033496 CAAATACAAATAATGTTTCTTGG - Intergenic
1053573598 9:39335109-39335131 GACCCAGCAATCTTGTTTCTTGG - Intergenic
1053838219 9:42163668-42163690 GACCCAGCAATCTTGTTTCTTGG - Intergenic
1053892602 9:42709451-42709473 GACCCAACAATCTTGTTTCTTGG - Intergenic
1054116633 9:61169718-61169740 GACCCAGCAATCTTGTTTCTTGG - Intergenic
1054123546 9:61283900-61283922 GACCCAGCAATCTTGTTTCTTGG + Intergenic
1054591124 9:67012843-67012865 GACCCAGCAATCTTGTTTCTTGG + Intergenic
1056742700 9:89273589-89273611 CAACTACGAATATTATGTCTAGG - Intergenic
1058267963 9:102930371-102930393 CAAGTACCCATATTCTTTCTTGG + Intergenic
1186739293 X:12500322-12500344 TATCTGCCAAGATTGTTTCTAGG + Intronic
1188323185 X:28765844-28765866 CTCCTTTCAATATTCTTTCTGGG + Intronic
1188655659 X:32692312-32692334 AACCTAACAATTCTGTTTCTGGG + Intronic
1189392518 X:40588259-40588281 CAACTACAAATACTGTTTCCTGG + Intronic
1189863606 X:45299992-45300014 GACCGAGCAATATTATTTCTAGG + Intergenic
1190616701 X:52241113-52241135 TACCTAGCCATATTGTTCCTGGG - Intergenic
1191164391 X:57372160-57372182 CACCTATCAATACTATTACTGGG - Intronic
1193315288 X:80057797-80057819 CACCTAGCAATACTTTTTCTTGG - Intergenic
1194894819 X:99427339-99427361 CACCCTCCAAGATTGTTACTAGG + Intergenic
1196326097 X:114404949-114404971 CACCTCCCAACACTGTTGCTTGG - Intergenic