ID: 1104495054

View in Genome Browser
Species Human (GRCh38)
Location 12:129229172-129229194
Sequence CAGGGTAAACACTCAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104495048_1104495054 24 Left 1104495048 12:129229125-129229147 CCAGTTCCAACAACGGAGGCTAA 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1104495054 12:129229172-129229194 CAGGGTAAACACTCAGCTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 161
1104495049_1104495054 18 Left 1104495049 12:129229131-129229153 CCAACAACGGAGGCTAAAACTTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1104495054 12:129229172-129229194 CAGGGTAAACACTCAGCTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104495054 Original CRISPR CAGGGTAAACACTCAGCTTC GGG Intronic
900873975 1:5328090-5328112 CAGGGTTAGCCCTCAGCTGCTGG - Intergenic
901512163 1:9722794-9722816 CAGGGTACACACTAAGCCTCAGG - Intronic
902371340 1:16009008-16009030 CAGGATTAAGACTCAGCCTCCGG - Intergenic
905652120 1:39663466-39663488 CAGGGTCAACCCTGGGCTTCAGG + Intronic
910422205 1:87078441-87078463 CACGGTTTACACTCTGCTTCAGG + Intronic
912176524 1:107164918-107164940 CAGGGGAACCACACAGCGTCAGG - Intronic
913655744 1:120957826-120957848 CAGGATACACTCTGAGCTTCTGG + Intergenic
917619361 1:176780332-176780354 CACTGTATACACTCAACTTCAGG - Intronic
1063773260 10:9228817-9228839 CAGGAGAAACAATCAGCATCAGG + Intergenic
1067078458 10:43201130-43201152 CAGGCTCAAGACTGAGCTTCTGG + Intronic
1068611794 10:59068353-59068375 CTGGTTAAACAATCATCTTCAGG + Intergenic
1070824773 10:79384778-79384800 CATGGTAAACACTGAATTTCAGG + Exonic
1070916954 10:80161136-80161158 CAGGATAAATACCCAGCTCCGGG + Intronic
1071516934 10:86304239-86304261 CATCTTAAACACACAGCTTCTGG - Intronic
1072297585 10:94026153-94026175 CAGGGTAAGTTTTCAGCTTCAGG - Intronic
1072987399 10:100153185-100153207 CAGCTTAAACATCCAGCTTCTGG - Intronic
1076750201 10:132538424-132538446 CAGGGTCAACGGTCAGCTGCTGG - Intronic
1077396119 11:2323025-2323047 CAGAGTAAACACACAGCCTAAGG + Intergenic
1078029288 11:7733032-7733054 CAGGGTAAACAGACAACCTCAGG + Intergenic
1078642432 11:13109061-13109083 CAGGGGAACCACTCACCTTTGGG + Intergenic
1078683500 11:13503771-13503793 CAGTGGAAACACTCAGGATCTGG + Intergenic
1079096972 11:17517311-17517333 CAGTGCAGACACCCAGCTTCAGG - Intronic
1079361069 11:19770717-19770739 CAGGGTAAAAAATAAGTTTCAGG - Intronic
1082981391 11:59126447-59126469 CAGGGTAAACACACAACCTACGG + Exonic
1083649839 11:64196093-64196115 CATGTTAAAAAATCAGCTTCAGG + Intronic
1085095840 11:73760382-73760404 CAGGGTAAAAACTCGGCCACTGG + Intronic
1085177940 11:74507128-74507150 CAGGGTCAACACTCAGAACCAGG - Intronic
1090255101 11:125278444-125278466 CTGGGTAGACACTCAGCGCCAGG - Intronic
1090521166 11:127480865-127480887 CAGGCTAGACTCTCAGCTTCTGG + Intergenic
1091228198 11:133970768-133970790 CATGATAAGAACTCAGCTTCCGG + Intergenic
1091242634 11:134064189-134064211 CAGGGTCAACCCTCGGTTTCAGG - Intergenic
1091604443 12:1937994-1938016 CAGGCTGAACACTCAGGTCCTGG + Intergenic
1094245391 12:28285979-28286001 CAGGGTAGACACTGAGCCTTAGG - Intronic
1095247398 12:39938995-39939017 CAGGGTCAACACTCAAGTTGAGG + Intronic
1096058612 12:48677382-48677404 TGTGGTAAACACTCAGCTTAAGG - Intronic
1097231987 12:57518331-57518353 CAGGGTAAAAACTAAACTACAGG + Intronic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1100459419 12:94784510-94784532 CATGGTAGACACTGAGGTTCTGG - Intergenic
1100946035 12:99784835-99784857 CAGGAAAAACACTAAACTTCAGG - Intronic
1101905919 12:108826457-108826479 CAGGGTGATCTCACAGCTTCGGG - Intronic
1104495054 12:129229172-129229194 CAGGGTAAACACTCAGCTTCGGG + Intronic
1107845918 13:44512496-44512518 CAGAGGAAACACTAAGCTTAAGG - Intronic
1108270074 13:48750869-48750891 CAGTGGAACCTCTCAGCTTCAGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113040593 13:106100503-106100525 CTGGGGACACCCTCAGCTTCTGG - Intergenic
1114400173 14:22402781-22402803 CAGTGTAAAAACTGAGCATCTGG + Intergenic
1114421267 14:22585471-22585493 CAAGATAAACAGTCAGCTACTGG + Intronic
1117930857 14:60839022-60839044 CAGGGTACCCACTCTGCTTGTGG - Intronic
1118355755 14:65012215-65012237 ACGGGTAAACACTCAGCTTCAGG - Intronic
1120407704 14:84109548-84109570 CAGGGTAAACTCTCATATTAAGG - Intergenic
1121725494 14:96145634-96145656 CAGGGTATAAAATCAACTTCTGG + Intergenic
1122107276 14:99467932-99467954 GAGGGTAAATACTGAGCTCCAGG - Intronic
1122111139 14:99503346-99503368 CTGAGTAAACACTAAGTTTCAGG - Exonic
1123194000 14:106599402-106599424 CAGGCTCAAAGCTCAGCTTCAGG - Intergenic
1123199608 14:106650258-106650280 CAGGTTCAAGGCTCAGCTTCAGG - Intergenic
1124805158 15:32874352-32874374 CAGCTTAAACACTCAACTTTGGG + Intronic
1124891813 15:33740659-33740681 TAGGGTATACAGTCAGCTCCAGG + Intronic
1125283547 15:38069245-38069267 GAGGGGAAACACGGAGCTTCCGG - Intergenic
1129193232 15:73949733-73949755 CACCGTAAACACTCAGCTTGGGG - Intronic
1130852955 15:87815955-87815977 CAGGCTGAACAATCTGCTTCTGG + Intergenic
1132497498 16:270812-270834 CAGGAGAAAACCTCAGCTTCTGG - Exonic
1135990720 16:27217079-27217101 CATGGTAGACACTCAGCTCTGGG - Intronic
1137825280 16:51489530-51489552 CAGGGTAAGGCCTCACCTTCAGG - Intergenic
1138200329 16:55083600-55083622 CAGGGAACACACTCAGCCTTGGG + Intergenic
1141316501 16:82967483-82967505 CAGAGTAATCACTTAGCTTTAGG - Intronic
1142124236 16:88402252-88402274 CAGGGTCACCACTGTGCTTCTGG - Intergenic
1146057009 17:29586497-29586519 CAGGATGAACACTCAGGTGCAGG + Intronic
1146594409 17:34156655-34156677 CAGGATAAACTCACAGCATCTGG - Intronic
1149827545 17:59843366-59843388 CAGGCTAAACAATTTGCTTCAGG - Intergenic
1151827645 17:76532014-76532036 GAGGGTAAGAACTCAGGTTCTGG + Intronic
1152046154 17:77937167-77937189 CAGGGTCCACGCTCAGCTCCTGG + Intergenic
1159416888 18:68163454-68163476 CATGATAAACACTCATCTTAAGG - Intergenic
1162336786 19:10066550-10066572 CAGGGTACACTCTCTGTTTCAGG + Intergenic
1163368105 19:16887623-16887645 CAGAGTCAACACCCAGCTCCAGG - Intergenic
1164191608 19:22923302-22923324 CAGGAGAATCACTCAGATTCTGG - Intergenic
927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG + Intergenic
928722795 2:34140014-34140036 CAGGGGAAACACGAATCTTCAGG + Intergenic
931331176 2:61285806-61285828 GAGGTTCAACATTCAGCTTCAGG + Intronic
939472930 2:142647831-142647853 CAGGAGAAAAACACAGCTTCAGG - Intergenic
940400398 2:153242209-153242231 CAGGTTTAATTCTCAGCTTCTGG + Intergenic
941894191 2:170612990-170613012 CAGGGGCAACACTCAGCTTAGGG + Intronic
943480942 2:188416521-188416543 AAGGCTAGACACTCAGTTTCAGG + Intronic
944957415 2:204828339-204828361 CAGGGCAAAAACTGAGCCTCAGG - Intronic
946231745 2:218295677-218295699 CAGGGTAAAATCTCAATTTCTGG - Intronic
946618880 2:221539760-221539782 CAGGATCAACACTCAGATTTAGG + Intronic
946848379 2:223881356-223881378 CAGGGTATCCACTCAGTTACTGG + Intronic
948047546 2:234955267-234955289 CAACGTTTACACTCAGCTTCTGG + Intronic
1169573410 20:6930935-6930957 CAGAGAAAACACTCAGCTTTGGG - Intergenic
1169855968 20:10103066-10103088 CAAGGAATACCCTCAGCTTCAGG - Intergenic
1169928686 20:10808875-10808897 CAGGACAAACACTCAACTTCAGG + Intergenic
1171292377 20:23989706-23989728 CAGGGCAGACACTCACCCTCAGG + Intergenic
1172674181 20:36655742-36655764 AAGGGTAAAAATTCAGCTGCAGG - Intronic
1173639128 20:44587129-44587151 CAGGGTAAAGACACTGCCTCTGG + Intronic
1173719941 20:45248253-45248275 CAGGGAAAACACTCAACGTGTGG + Intergenic
1174069436 20:47889395-47889417 CAGGGGGCACACTCAGCCTCAGG - Intergenic
1175156260 20:56973551-56973573 GAGGGAAAACACTGAGCTTCAGG - Intergenic
1180187649 21:46147392-46147414 CAAGCCAAAAACTCAGCTTCAGG + Intronic
1180825850 22:18860748-18860770 CAGAGTAGAAACTCAGTTTCTGG + Intronic
1180954496 22:19735603-19735625 AAGGCTAACCACTCAGCTTCCGG + Intergenic
1181186884 22:21113802-21113824 CAGAGTAGAAACTCAGTTTCTGG - Intergenic
1181209900 22:21283416-21283438 CAGGGTAGACACTCGCCCTCAGG + Intergenic
1181212318 22:21296691-21296713 CAGAGTAGAAACTCAGTTTCTGG + Intergenic
1181399615 22:22643528-22643550 CAGGGCAGACACTCACCCTCAGG - Intergenic
1181649801 22:24252540-24252562 CAGGGCAGACACTCACCCTCAGG + Intergenic
1181707573 22:24658206-24658228 CAGGGCAGACACTCACCCTCAGG - Intergenic
1182159655 22:28108311-28108333 CAGCATAATCACTCAGCTCCTGG + Exonic
1183291254 22:37003267-37003289 CTTGTTAAACACTCAGATTCAGG - Intronic
1183964281 22:41431970-41431992 CAGGGCAAACATCCAACTTCTGG - Intergenic
1185097989 22:48822045-48822067 CAGGGAAGACGCTGAGCTTCTGG - Intronic
1203273585 22_KI270734v1_random:73373-73395 CAGGGCAGACACTCACCCTCAGG + Intergenic
1203275992 22_KI270734v1_random:86653-86675 CAGAGTAGAAACTCAGTTTCTGG + Intergenic
949669342 3:6380553-6380575 CAGGCTAGACACTGAGATTCAGG + Intergenic
950687924 3:14632143-14632165 CAAGATAAACACTCATGTTCTGG + Intergenic
950876173 3:16276570-16276592 ATGGGTAAAAACTCAGCTTCTGG + Intronic
953778184 3:45841564-45841586 CAGGGTTCTCACTCAGTTTCAGG - Intronic
953958380 3:47248213-47248235 CAGGGTATGCTTTCAGCTTCTGG + Intronic
954870544 3:53764488-53764510 GGGTGTAAACACTTAGCTTCCGG + Intronic
955008707 3:54993625-54993647 CAGGGCAAACCCTCAAGTTCTGG - Intronic
962043131 3:131728392-131728414 GAGGTTAAACACACAGGTTCTGG - Intronic
967975677 3:195033488-195033510 CCGGTTAAACACTTAGCTTTAGG - Intergenic
968131561 3:196195574-196195596 CAGGGGACACACTCAGCCTCAGG - Intergenic
968219670 3:196927137-196927159 AAAGGTTAACATTCAGCTTCTGG - Intronic
975616411 4:76251817-76251839 CCAGGTAAACACTCAGCGCCCGG + Exonic
977710269 4:100116392-100116414 CAGGATCCACACTCAGCTTTAGG + Intergenic
982094810 4:151912121-151912143 CAGGGTAATGGCTCAGCCTCAGG - Intergenic
983790324 4:171789139-171789161 CAGGGTAAGGAGTTAGCTTCAGG - Intergenic
985312124 4:188613819-188613841 CAGGATTATCAGTCAGCTTCTGG + Intergenic
986130248 5:4923472-4923494 GAGGGTAAGAACTCAGCATCTGG - Intergenic
990350205 5:54908544-54908566 CAGGGTTAATAGTCAGATTCTGG - Intergenic
990411505 5:55545745-55545767 CATGGCAAACACACAACTTCTGG + Intergenic
992763219 5:79970195-79970217 CAGGTGATACATTCAGCTTCAGG + Intergenic
993478901 5:88398138-88398160 CAGGCAAAATACCCAGCTTCAGG + Intergenic
996075332 5:119186158-119186180 CAGAGTATACACGAAGCTTCAGG - Intronic
999378872 5:151106095-151106117 CTGGGGAAACACTCAGCCCCAGG - Intronic
999438236 5:151581080-151581102 CAGGCCACACACTCAGGTTCTGG + Intergenic
999674124 5:153982058-153982080 CAGTGAAAACAGCCAGCTTCTGG - Intergenic
1000596840 5:163224647-163224669 CAGGGTAAAGGCTCAGGTTAAGG - Intergenic
1001083724 5:168685560-168685582 CAGGGACAACACTCAGCTTGAGG - Intronic
1001982935 5:176048586-176048608 CAGGGTGAACATTAGGCTTCTGG - Intergenic
1002071923 5:176683975-176683997 CAGGGAAAACCCTCTGATTCTGG + Intergenic
1002234528 5:177795470-177795492 CAGGGTGAACATTAGGCTTCTGG + Intergenic
1002574881 5:180168849-180168871 CAGGAGAAACCCTCTGCTTCTGG - Intronic
1004787761 6:18987997-18988019 CTGAGGAAACACACAGCTTCAGG + Intergenic
1005065747 6:21816057-21816079 AAGGATAAAACCTCAGCTTCTGG - Intergenic
1009011068 6:57842984-57843006 CAGGGAAAAGACTCACCTTTTGG - Intergenic
1009410851 6:63363118-63363140 CAGTGAGAACACTCAGCTGCAGG - Intergenic
1009592161 6:65686823-65686845 CAGTGTCAATACCCAGCTTCAGG - Intronic
1015157588 6:130113786-130113808 CAGGGTACAGACTCGGCTTTCGG - Intronic
1015538204 6:134288089-134288111 CTTGGTAAACACTAACCTTCCGG - Intronic
1016591047 6:145743522-145743544 CAGGGTCATTACTCAACTTCTGG - Intergenic
1020051942 7:5087485-5087507 CAGGGTACATGGTCAGCTTCTGG + Intergenic
1020828882 7:13067774-13067796 TAGAGTAAAAACTCAGCTGCAGG - Intergenic
1021891921 7:25194573-25194595 CAGGGCAAACATTCAGCCTGAGG + Intergenic
1023515038 7:40993363-40993385 CAGGGTAAGCAGACAGCATCAGG - Intergenic
1024851029 7:53716974-53716996 CAGGGGAAACATTTAGCCTCAGG - Intergenic
1025023253 7:55496324-55496346 CAGGGGCAAGACCCAGCTTCAGG - Intronic
1025163493 7:56687675-56687697 AAGTGTAAACACTCAACTCCTGG + Intergenic
1025232386 7:57211327-57211349 CAGGGTGCACACCCAGCCTCAGG - Intergenic
1025910706 7:65826171-65826193 CAGGGGAAACACTGAGTTTAGGG + Intergenic
1026866992 7:73830134-73830156 CAGGGTAAACACCCATTTACTGG + Exonic
1027993174 7:85390052-85390074 CAGAATAAACACTAAGATTCTGG + Intergenic
1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG + Intergenic
1030358433 7:108569488-108569510 ACGGATAAAAACTCAGCTTCCGG + Exonic
1030422254 7:109322463-109322485 CAGGAAAGACACTCAGCCTCGGG + Intergenic
1032237987 7:130141175-130141197 CAGGGACAAAACCCAGCTTCTGG + Intergenic
1034887415 7:154808571-154808593 CAGGGAATCCACTCAACTTCTGG - Intronic
1035408978 7:158623380-158623402 ATGGATAAAAACTCAGCTTCCGG + Intergenic
1036916730 8:12811412-12811434 CATGGTAAACTCTCAGCTTCTGG - Intergenic
1038353675 8:26806274-26806296 TGGTGTAAACACCCAGCTTCTGG - Intronic
1038417204 8:27405661-27405683 CAAGGTAGACACGCAGGTTCCGG + Intronic
1042823363 8:72955828-72955850 CAGAGTCAACACTCAACTCCTGG + Intergenic
1050634164 9:7592619-7592641 CAGAGAAAGCACTCAGCTGCGGG + Intergenic
1050942995 9:11484296-11484318 TAGGGTCAACATTCAGATTCAGG - Intergenic
1052136929 9:24923933-24923955 GAGGGTAAACACCCAGTTTCTGG + Intergenic
1061216632 9:129225459-129225481 CAGGGTGAGCACTCTGCTTGTGG - Intergenic
1061739191 9:132687321-132687343 AAGGGAAAGCACTCACCTTCTGG - Exonic
1186875515 X:13812733-13812755 CAGGGTTTACACTCAATTTCAGG + Intronic